NM_001814.6:c.758-1003_758-984delTGGATAGTATCATCTGCATG

Variant names:

• chr11-88297247-CCATGCAGATGATACTATCCA-C
• NM_001814.6:c.758-1003_758-984delTGGATAGTATCATCTGCATG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001814.6(CTSC):​c.758-1003_758-984delTGGATAGTATCATCTGCATG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CTSC NM_001814.6 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.62
• Publications: 0 publications found

Genes affected

CTSC (HGNC:2528): (cathepsin C) This gene encodes a member of the peptidase C1 family and lysosomal cysteine proteinase that appears to be a central coordinator for activation of many serine proteinases in cells of the immune system. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate heavy and light chains that form a disulfide-linked dimer. A portion of the propeptide acts as an intramolecular chaperone for the folding and stabilization of the mature enzyme. This enzyme requires chloride ions for activity and can degrade glucagon. Defects in the encoded protein have been shown to be a cause of Papillon-Lefevre syndrome, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. [provided by RefSeq, Nov 2015]

CTSC Gene-Disease associations (from GenCC):

• Haim-Munk syndrome

  Inheritance: AR, Unknown Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Papillon-Lefevre disease

  Inheritance: Unknown, AR Classification: DEFINITIVE, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
• ectodermal dysplasia syndrome

  Inheritance: AR Classification: STRONG Submitted by: Illumina
• periodontitis, aggressive 1

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001814.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTSC	NM_001814.6	MANE Select	c.758-1003_758-984delTGGATAGTATCATCTGCATG		intron	N/A	NP_001805.4	P53634-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTSC	ENST00000227266.10	TSL:1 MANE Select	c.758-1003_758-984delTGGATAGTATCATCTGCATG		intron	N/A	ENSP00000227266.4	P53634-1
	CTSC	ENST00000880823.1		c.758-1003_758-984delTGGATAGTATCATCTGCATG		intron	N/A	ENSP00000550882.1
	CTSC	ENST00000880825.1		c.746-1003_746-984delTGGATAGTATCATCTGCATG		intron	N/A	ENSP00000550884.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr11-88030415;