chr11-88297247-CCATGCAGATGATACTATCCA-C
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001814.6(CTSC):c.758-1003_758-984delTGGATAGTATCATCTGCATG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001814.6 intron
Scores
Clinical Significance
Conservation
Publications
- Haim-Munk syndromeInheritance: AR, Unknown Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- Papillon-Lefevre diseaseInheritance: Unknown, AR Classification: DEFINITIVE, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
- ectodermal dysplasia syndromeInheritance: AR Classification: STRONG Submitted by: Illumina
- periodontitis, aggressive 1Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001814.6. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CTSC | TSL:1 MANE Select | c.758-1003_758-984delTGGATAGTATCATCTGCATG | intron | N/A | ENSP00000227266.4 | P53634-1 | |||
| CTSC | c.758-1003_758-984delTGGATAGTATCATCTGCATG | intron | N/A | ENSP00000550882.1 | |||||
| CTSC | c.746-1003_746-984delTGGATAGTATCATCTGCATG | intron | N/A | ENSP00000550884.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at