NM_001903.5:c.-2-5766_-2-5573del

Variant names:

• chr5-138776155-AAAGGTCTCTGGTTTTCCTATGCAGAGGACCCTGCGGCCTTCCGCAGTGTTTGTGTCCCTGGGTACTTGAGATTAGGGAGTGGTGATGACTCTTAACGAGCATGCTGCCTTCAAGCATCTGTTCAACAAAGCACATCTTGCACCACCTCAATCCATTCAACCCTGAGTGGACACACCACATGTTTCAGAGAGCAC-A
• NM_001903.5:c.-2-5766_-2-5573del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001903.5(CTNNA1):​c.-2-5766_-2-5573del variant causes a intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 30)
• Consequence: CTNNA1 NM_001903.5 intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: No conservation score assigned
• Publications: 0 publications found

Genes affected

CTNNA1 (HGNC:2509): (catenin alpha 1) This gene encodes a member of the catenin family of proteins that play an important role in cell adhesion process by connecting cadherins located on the plasma membrane to the actin filaments inside the cell. The encoded mechanosensing protein contains three vinculin homology domains and undergoes conformational changes in response to cytoskeletal tension, resulting in the reconfiguration of cadherin-actin filament connections. Certain mutations in this gene cause butterfly-shaped pigment dystrophy. [provided by RefSeq, May 2016]

CTNNA1 Gene-Disease associations (from GenCC):

• CTNNA1-related diffuse gastric and lobular breast cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• patterned macular dystrophy 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• patterned macular dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary nonpolyposis colon cancer

  Inheritance: Unknown Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001903.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNNA1	NM_001903.5	MANE Select	c.-2-5766_-2-5573del		intron	N/A	NP_001894.2	A0A384MDY0
	CTNNA1	NM_001323982.2		c.-2-5766_-2-5573del		intron	N/A	NP_001310911.1	P35221-1
	CTNNA1	NM_001323983.1		c.-2-5766_-2-5573del		intron	N/A	NP_001310912.1	A0A384MDY0

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNNA1	ENST00000302763.12	TSL:1 MANE Select	c.-2-5767_-2-5574del		intron	N/A	ENSP00000304669.7	P35221-1
	CTNNA1	ENST00000965845.1		c.-2-5767_-2-5574del		intron	N/A	ENSP00000635904.1
	CTNNA1	ENST00000930310.1		c.-2-5767_-2-5574del		intron	N/A	ENSP00000600369.1

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	Schizophrenia (1)

Computational scores

Source: dbNSFP v4.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr5-138111844;