NM_001940.4:c.1488_1508delGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr12-6936728-ACAGCAGCAGCAGCAGCAGCAG-A
• rs60216939
• NM_001940.4:c.1488_1508delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP6 BA1

The NM_001940.4(ATN1):​c.1488_1508delGCAGCAGCAGCAGCAGCAGCA​(p.Gln496_Gln502del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.112 in 1,583,744 control chromosomes in the GnomAD database, including 9,431 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. Q496Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.097 (728 hom., cov: 0)
  • Exomes 𝑓: 0.11 (8703 hom.)
• Consequence: ATN1 NM_001940.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:2
• Conservation: PhyloP100: 4.09
• Publications: 8 publications found

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ATN1 Gene-Disease associations (from GenCC):

• congenital hypotonia, epilepsy, developmental delay, and digital anomalies

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Illumina, Ambry Genetics
• dentatorubral-pallidoluysian atrophy

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• BP6: Variant 12-6936728-ACAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr12-6936728-ACAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 917563.
• BA1: GnomAd4 highest subpopulation (SAS) allele frequency at 95% confidence interval = 0.119 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001940.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	NM_001940.4	MANE Select	c.1488_1508delGCAGCAGCAGCAGCAGCAGCA	p.Gln496_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001931.2	P54259
	ATN1	NM_001007026.2		c.1488_1508delGCAGCAGCAGCAGCAGCAGCA	p.Gln496_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001007027.1	P54259
	ATN1	NM_001424176.1		c.1488_1508delGCAGCAGCAGCAGCAGCAGCA	p.Gln496_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001411105.1	P54259

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	ENST00000396684.3	TSL:1 MANE Select	c.1488_1508delGCAGCAGCAGCAGCAGCAGCA	p.Gln496_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENSP00000379915.2	P54259
	ATN1	ENST00000356654.8	TSL:1	c.1488_1508delGCAGCAGCAGCAGCAGCAGCA	p.Gln496_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENSP00000349076.3	P54259
	ATN1	ENST00000882240.1		c.1488_1508delGCAGCAGCAGCAGCAGCAGCA	p.Gln496_Gln502del	disruptive_inframe_deletion	Exon 5 of 11	ENSP00000552299.1

Frequencies

GnomAD3 genomes AF: 0.0966 AC: 14000 AN: 144970 Hom.: 727 Cov.: 0

Gnomad AFR AF: 0.0594

Gnomad AMI AF: 0.188

Gnomad AMR AF: 0.0940

Gnomad ASJ AF: 0.136

Gnomad EAS AF: 0.0277

Gnomad SAS AF: 0.125

Gnomad FIN AF: 0.0722

Gnomad MID AF: 0.211

Gnomad NFE AF: 0.121

Gnomad OTH AF: 0.117

GnomAD4 exome AF: 0.114 AC: 163947 AN: 1438672 Hom.: 8703 AF XY: 0.115 AC XY: 82161 AN XY: 716576

African (AFR) AF: 0.0599 AC: 1928 AN: 32174

American (AMR) AF: 0.0711 AC: 2850 AN: 40108

Ashkenazi Jewish (ASJ) AF: 0.131 AC: 3357 AN: 25676

East Asian (EAS) AF: 0.0196 AC: 759 AN: 38780

South Asian (SAS) AF: 0.121 AC: 10318 AN: 85524

European-Finnish (FIN) AF: 0.0770 AC: 4046 AN: 52568

Middle Eastern (MID) AF: 0.202 AC: 1158 AN: 5720

European-Non Finnish (NFE) AF: 0.121 AC: 132747 AN: 1098670

Other (OTH) AF: 0.114 AC: 6784 AN: 59452

GnomAD4 genome AF: 0.0965 AC: 14001 AN: 145072 Hom.: 728 Cov.: 0 AF XY: 0.0949 AC XY: 6685 AN XY: 70442

African (AFR) AF: 0.0594 AC: 2301 AN: 38758

American (AMR) AF: 0.0938 AC: 1303 AN: 13888

Ashkenazi Jewish (ASJ) AF: 0.136 AC: 459 AN: 3370

East Asian (EAS) AF: 0.0278 AC: 131 AN: 4720

South Asian (SAS) AF: 0.125 AC: 554 AN: 4426

European-Finnish (FIN) AF: 0.0722 AC: 727 AN: 10074

Middle Eastern (MID) AF: 0.208 AC: 60 AN: 288

European-Non Finnish (NFE) AF: 0.121 AC: 8064 AN: 66678

Other (OTH) AF: 0.119 AC: 235 AN: 1982

Alfa AF: 0.0755 Hom.: 123

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	1	not provided (2)
-	1	1	not specified (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1
Mutation Taster		=165/35	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891; COSMIC: COSV63110183; COSMIC: COSV63110183;