NM_001943.5:c.-21_6dupGGAGGCGGAGGCGAGGGTGCGATGGCG

Variant names:

• chr18-31498226-C-CGGCGGGAGGCGGAGGCGAGGGTGCGAT
• NM_001943.5:c.-21_6dupGGAGGCGGAGGCGAGGGTGCGATGGCG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001943.5(DSG2):​c.-21_6dupGGAGGCGGAGGCGAGGGTGCGATGGCG​(p.Ala2_Arg3insGlyGlyGlyGlyGluGlyAlaMetAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000911 in 1,097,834 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 9.1e-7 (0 hom.)
• Consequence: DSG2 NM_001943.5 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.150

Genes affected

DSG2 (HGNC:3049): (desmoglein 2) This gene encodes a member of the desmoglein family and cadherin cell adhesion molecule superfamily of proteins. Desmogleins are calcium-binding transmembrane glycoprotein components of desmosomes, cell-cell junctions between epithelial, myocardial, and other cell types. The encoded preproprotein is proteolytically processed to generate the mature glycoprotein. This gene is present in a gene cluster with other desmoglein gene family members on chromosome 18. Mutations in this gene have been associated with arrhythmogenic right ventricular dysplasia, familial, 10. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DSG2	NM_001943.5	c.-21_6dupGGAGGCGGAGGCGAGGGTGCGATGGCG	p.Ala2_Arg3insGlyGlyGlyGlyGluGlyAlaMetAla	conservative_inframe_insertion	Exon 1 of 15	ENST00000261590.13	NP_001934.2
DSG2	XM_047437315.1	c.-593_-567dupGGAGGCGGAGGCGAGGGTGCGATGGCG		5_prime_UTR_variant	Exon 1 of 16		XP_047293271.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DSG2	ENST00000261590.13	c.-21_6dupGGAGGCGGAGGCGAGGGTGCGATGGCG	p.Ala2_Arg3insGlyGlyGlyGlyGluGlyAlaMetAla	conservative_inframe_insertion	Exon 1 of 15	1	NM_001943.5	ENSP00000261590.8

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 9.11e-7 AC: 1 AN: 1097834 Hom.: 0 Cov.: 30 AF XY: 0.00000192 AC XY: 1 AN XY: 521610

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000108

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr18-29078189;