NM_002249.6:c.206_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
• rs3831942
• NM_002249.6:c.206_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_002249.6(KCNN3):​c.206_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln69_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00028 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00011 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.12
• Publications: 18 publications found

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

KCNN3 Gene-Disease associations (from GenCC):

• Zimmermann-Laband syndrome 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Zimmermann-Laband syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000308854 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_002249.6

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002249.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	NM_002249.6	MANE Select	c.206_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln69_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	NP_002240.3
	KCNN3	NM_001204087.2		c.206_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln69_Gln80dup	conservative_inframe_insertion	Exon 1 of 9	NP_001191016.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	ENST00000271915.9	TSL:1 MANE Select	c.206_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln69_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	ENSP00000271915.3
	KCNN3	ENST00000618040.4	TSL:5	c.206_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln69_Gln80dup	conservative_inframe_insertion	Exon 1 of 9	ENSP00000481848.1
	ENSG00000308854	ENST00000836873.1		n.195-652_195-617dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.000276 AC: 39 AN: 141288 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000636

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000283

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000648

Gnomad SAS AF: 0.000988

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000460

Gnomad OTH AF: 0.000531

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000106 AC: 145 AN: 1365126 Hom.: 0 Cov.: 112 AF XY: 0.000133 AC XY: 90 AN XY: 674888

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000225 AC: 7 AN: 31108

American (AMR) AF: 0.000366 AC: 13 AN: 35512

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24960

East Asian (EAS) AF: 0.000478 AC: 17 AN: 35568

South Asian (SAS) AF: 0.000940 AC: 74 AN: 78746

European-Finnish (FIN) AF: 0.0000217 AC: 1 AN: 46140

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4434

European-Non Finnish (NFE) AF: 0.0000228 AC: 24 AN: 1051856

Other (OTH) AF: 0.000158 AC: 9 AN: 56802

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000276 AC: 39 AN: 141390 Hom.: 0 Cov.: 0 AF XY: 0.000338 AC XY: 23 AN XY: 68016

African (AFR) AF: 0.000634 AC: 24 AN: 37840

American (AMR) AF: 0.000283 AC: 4 AN: 14158

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3376

East Asian (EAS) AF: 0.000650 AC: 3 AN: 4614

South Asian (SAS) AF: 0.000990 AC: 4 AN: 4042

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9120

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.0000460 AC: 3 AN: 65186

Other (OTH) AF: 0.000526 AC: 1 AN: 1902

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;