NM_002249.6:c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 2P and 4B. PP5_ModerateBS2
The NM_002249.6(KCNN3):c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC(p.Gln70_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_002249.6 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Zimmermann-Laband syndrome 3Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- Zimmermann-Laband syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- schizophreniaInheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
KCNN3 | NM_002249.6 | c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln70_Gln80dup | conservative_inframe_insertion | Exon 1 of 8 | ENST00000271915.9 | NP_002240.3 | |
KCNN3 | NM_001204087.2 | c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln70_Gln80dup | conservative_inframe_insertion | Exon 1 of 9 | NP_001191016.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000595 AC: 84AN: 141286Hom.: 2 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000173 AC: 236AN: 1365110Hom.: 0 Cov.: 112 AF XY: 0.000207 AC XY: 140AN XY: 674876 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000594 AC: 84AN: 141388Hom.: 2 Cov.: 0 AF XY: 0.000647 AC XY: 44AN XY: 68016 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at