NM_002485.5:c.900_924delAGGTCTTAGACCTATTCCTGAAGCA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_002485.5(NBN):c.900_924delAGGTCTTAGACCTATTCCTGAAGCA(p.Gly301LysfsTer6) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. Q300Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002485.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- Nijmegen breakage syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Myriad Women’s Health
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- idiopathic aplastic anemiaInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
- prostate cancerInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Microcephaly, normal intelligence and immunodeficiency Pathogenic:2
- -
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. ClinVar contains an entry for this variant (Variation ID: 375604). This variant has not been reported in the literature in individuals affected with NBN-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly301Lysfs*6) in the NBN gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in NBN are known to be pathogenic (PMID: 9590180, 16415040). -
Aplastic anemia Pathogenic:1
- -
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.900_924del25 pathogenic mutation (also known as p.G301Kfs*6) is located in coding exon 8 of the NBN gene, results from a deletion of 25 nucleotides at positions c.900 to c.925 causing a translational frameshift with a predicted alternate stop codon (p.G301Kfs*6). This alteration has been reported in a homozygous state in a 2 year old girl from Morocco with clinical features consistent with Nijmegen breakage syndrome (NBS) (Maraschio P et al. J. Med. Genet., 2001 Feb;38:113-7). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at