rs1057519587

Variant names:

• chr8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C
• rs1057519587
• NM_002485.5:c.900_924delAGGTCTTAGACCTATTCCTGAAGCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_002485.5(NBN):​c.900_924delAGGTCTTAGACCTATTCCTGAAGCA​(p.Gly301LysfsTer6) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. Q300Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: NBN NM_002485.5 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 6.30
• Publications: 1 publications found

Genes affected

NBN (HGNC:7652): (nibrin) Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]

NBN Gene-Disease associations (from GenCC):

• Nijmegen breakage syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Myriad Women’s Health
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• idiopathic aplastic anemia

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• prostate cancer

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is Pathogenic according to our data. Variant chr8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 375604.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NBN	NM_002485.5	c.900_924delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly301LysfsTer6	frameshift_variant	Exon 8 of 16	ENST00000265433.8	NP_002476.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NBN	ENST00000265433.8	c.900_924delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly301LysfsTer6	frameshift_variant	Exon 8 of 16	1	NM_002485.5	ENSP00000265433.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Microcephaly, normal intelligence and immunodeficiency Pathogenic:2

Feb 02, 2017

GeneReviews

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Jun 05, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. ClinVar contains an entry for this variant (Variation ID: 375604). This variant has not been reported in the literature in individuals affected with NBN-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly301Lysfs*6) in the NBN gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in NBN are known to be pathogenic (PMID: 9590180, 16415040). -

Aplastic anemia Pathogenic:1

Sep 14, 2021

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1

Mar 30, 2020

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.900_924del25 pathogenic mutation (also known as p.G301Kfs*6) is located in coding exon 8 of the NBN gene, results from a deletion of 25 nucleotides at positions c.900 to c.925 causing a translational frameshift with a predicted alternate stop codon (p.G301Kfs*6). This alteration has been reported in a homozygous state in a 2 year old girl from Morocco with clinical features consistent with Nijmegen breakage syndrome (NBS) (Maraschio P et al. J. Med. Genet., 2001 Feb;38:113-7). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.3
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1057519587; hg19: chr8-90976707;