rs1057519587

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_002485.5(NBN):​c.900_924delAGGTCTTAGACCTATTCCTGAAGCA​(p.Gly301fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

NBN
NM_002485.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 6.30
Variant links:
Genes affected
NBN (HGNC:7652): (nibrin) Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is Pathogenic according to our data. Variant chr8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 375604.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
NBNNM_002485.5 linkuse as main transcriptc.900_924delAGGTCTTAGACCTATTCCTGAAGCA p.Gly301fs frameshift_variant 8/16 ENST00000265433.8 NP_002476.2 O60934

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
NBNENST00000265433.8 linkuse as main transcriptc.900_924delAGGTCTTAGACCTATTCCTGAAGCA p.Gly301fs frameshift_variant 8/161 NM_002485.5 ENSP00000265433.4 O60934

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Microcephaly, normal intelligence and immunodeficiency Pathogenic:2
Pathogenic, no assertion criteria providedliterature onlyGeneReviewsFeb 02, 2017- -
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpJun 05, 2023ClinVar contains an entry for this variant (Variation ID: 375604). For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with NBN-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly301Lysfs*6) in the NBN gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in NBN are known to be pathogenic (PMID: 9590180, 16415040). -
Aplastic anemia Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingBaylor GeneticsSep 14, 2021- -
Hereditary cancer-predisposing syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingAmbry GeneticsMar 30, 2020The c.900_924del25 pathogenic mutation (also known as p.G301Kfs*6) is located in coding exon 8 of the NBN gene, results from a deletion of 25 nucleotides at positions c.900 to c.925 causing a translational frameshift with a predicted alternate stop codon (p.G301Kfs*6). This alteration has been reported in a homozygous state in a 2 year old girl from Morocco with clinical features consistent with Nijmegen breakage syndrome (NBS) (Maraschio P et al. J. Med. Genet., 2001 Feb;38:113-7). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1057519587; hg19: chr8-90976707; API