rs1057519587

Variant names:

• chr8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C
• rs1057519587
• NM_002485.5:c.900_924delAGGTCTTAGACCTATTCCTGAAGCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_002485.5(NBN):​c.900_924delAGGTCTTAGACCTATTCCTGAAGCA​(p.Gly301LysfsTer6) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. Q300Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: NBN NM_002485.5 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 6.30
• Publications: 1 publications found

Genes affected

NBN (HGNC:7652): (nibrin) Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]

NBN Gene-Disease associations (from GenCC):

• Nijmegen breakage syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Myriad Women’s Health, G2P, Orphanet, ClinGen
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• idiopathic aplastic anemia

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• prostate cancer

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is Pathogenic according to our data. Variant chr8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 375604.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002485.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NBN	NM_002485.5	MANE Select	c.900_924delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly301LysfsTer6	frameshift	Exon 8 of 16	NP_002476.2
	NBN	NM_001024688.3		c.654_678delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly219LysfsTer6	frameshift	Exon 9 of 17	NP_001019859.1	A0A0C4DG07
	NBN	NM_001440379.1		c.654_678delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly219LysfsTer6	frameshift	Exon 8 of 16	NP_001427308.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NBN	ENST00000265433.8	TSL:1 MANE Select	c.900_924delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly301LysfsTer6	frameshift	Exon 8 of 16	ENSP00000265433.4	O60934
	NBN	ENST00000697309.1		c.900_924delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly301LysfsTer6	frameshift	Exon 8 of 15	ENSP00000513244.1	A0A8V8TKY5
	NBN	ENST00000697293.1		c.900_924delAGGTCTTAGACCTATTCCTGAAGCA	p.Gly301LysfsTer6	frameshift	Exon 8 of 17	ENSP00000513230.1	A0A8V8TM80

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Microcephaly, normal intelligence and immunodeficiency (2)
1	-	-	Aplastic anemia (1)
1	-	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.3
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1057519587; hg19: chr8-90976707;