rs1057519587

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_002485.5(NBN):​c.900_924delAGGTCTTAGACCTATTCCTGAAGCA​(p.Gly301LysfsTer6) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. Q300Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

NBN
NM_002485.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 6.30

Publications

1 publications found
Variant links:
Genes affected
NBN (HGNC:7652): (nibrin) Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
NBN Gene-Disease associations (from GenCC):
  • Nijmegen breakage syndrome
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Myriad Women’s Health
  • rhabdomyosarcoma
    Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
  • idiopathic aplastic anemia
    Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
  • prostate cancer
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
  • hereditary breast carcinoma
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is Pathogenic according to our data. Variant chr8-89964479-CTGCTTCAGGAATAGGTCTAAGACCT-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 375604.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NBNNM_002485.5 linkc.900_924delAGGTCTTAGACCTATTCCTGAAGCA p.Gly301LysfsTer6 frameshift_variant Exon 8 of 16 ENST00000265433.8 NP_002476.2 O60934

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NBNENST00000265433.8 linkc.900_924delAGGTCTTAGACCTATTCCTGAAGCA p.Gly301LysfsTer6 frameshift_variant Exon 8 of 16 1 NM_002485.5 ENSP00000265433.4 O60934

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Microcephaly, normal intelligence and immunodeficiency Pathogenic:2
Feb 02, 2017
GeneReviews
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Jun 05, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. ClinVar contains an entry for this variant (Variation ID: 375604). This variant has not been reported in the literature in individuals affected with NBN-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly301Lysfs*6) in the NBN gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in NBN are known to be pathogenic (PMID: 9590180, 16415040). -

Aplastic anemia Pathogenic:1
Sep 14, 2021
Baylor Genetics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1
Mar 30, 2020
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.900_924del25 pathogenic mutation (also known as p.G301Kfs*6) is located in coding exon 8 of the NBN gene, results from a deletion of 25 nucleotides at positions c.900 to c.925 causing a translational frameshift with a predicted alternate stop codon (p.G301Kfs*6). This alteration has been reported in a homozygous state in a 2 year old girl from Morocco with clinical features consistent with Nijmegen breakage syndrome (NBS) (Maraschio P et al. J. Med. Genet., 2001 Feb;38:113-7). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
6.3
Mutation Taster
=2/198
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1057519587; hg19: chr8-90976707; API