NM_002691.4:c.2435_2454dupTGCTCTTCTCCTCCCGGCCC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_002691.4(POLD1):c.2435_2454dupTGCTCTTCTCCTCCCGGCCC(p.Asp819CysfsTer76) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. D819D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002691.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- mandibular hypoplasia-deafness-progeroid syndromeInheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: G2P, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp
- POLD1-related polyposis and colorectal cancer syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- colorectal cancer, susceptibility to, 10Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- Polymerase proofreading-related adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- immunodeficiency 120Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
- non-severe combined immunodeficiency due to polymerase delta deficiencyInheritance: AR Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002691.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLD1 | MANE Select | c.2435_2454dupTGCTCTTCTCCTCCCGGCCC | p.Asp819CysfsTer76 | frameshift | Exon 20 of 27 | NP_002682.2 | P28340 | ||
| POLD1 | c.2513_2532dupTGCTCTTCTCCTCCCGGCCC | p.Asp845CysfsTer76 | frameshift | Exon 19 of 26 | NP_001295561.1 | M0R2B7 | |||
| POLD1 | c.2435_2454dupTGCTCTTCTCCTCCCGGCCC | p.Asp819CysfsTer76 | frameshift | Exon 20 of 27 | NP_001243778.1 | P28340 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLD1 | TSL:1 MANE Select | c.2435_2454dupTGCTCTTCTCCTCCCGGCCC | p.Asp819CysfsTer76 | frameshift | Exon 20 of 27 | ENSP00000406046.1 | P28340 | ||
| POLD1 | TSL:1 | c.2513_2532dupTGCTCTTCTCCTCCCGGCCC | p.Asp845CysfsTer76 | frameshift | Exon 20 of 27 | ENSP00000472445.1 | M0R2B7 | ||
| POLD1 | TSL:1 | c.2435_2454dupTGCTCTTCTCCTCCCGGCCC | p.Asp819CysfsTer76 | frameshift | Exon 20 of 27 | ENSP00000473052.1 | P28340 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at