NM_002691.4:c.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_002691.4(POLD1):​c.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG​(p.Gly113_Pro123del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G113G) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

POLD1
NM_002691.4 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 5.35

Publications

0 publications found
Variant links:
Genes affected
POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
POLD1 Gene-Disease associations (from GenCC):
  • POLD1-related polyposis and colorectal cancer syndrome
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • colorectal cancer, susceptibility to, 10
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
  • mandibular hypoplasia-deafness-progeroid syndrome
    Inheritance: AD, AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, Orphanet, G2P
  • Polymerase proofreading-related adenomatous polyposis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • immunodeficiency 120
    Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
  • non-severe combined immunodeficiency due to polymerase delta deficiency
    Inheritance: AR Classification: LIMITED Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_002691.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
POLD1NM_002691.4 linkc.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG p.Gly113_Pro123del disruptive_inframe_deletion Exon 4 of 27 ENST00000440232.7 NP_002682.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
POLD1ENST00000440232.7 linkc.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG p.Gly113_Pro123del disruptive_inframe_deletion Exon 4 of 27 1 NM_002691.4 ENSP00000406046.1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Colorectal cancer, susceptibility to, 10 Uncertain:1
Mar 13, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with POLD1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant, c.338_370del, results in the deletion of 11 amino acids of the POLD1 protein (p.Gly113_Pro123del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
5.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555789763; hg19: chr19-50905048; API