chr19-50401791-TGTGCCTGGGGGGCCCCCACCATCCCGCGGCTCC-T

Variant names:

• chr19-50401791-TGTGCCTGGGGGGCCCCCACCATCCCGCGGCTCC-T
• rs1555789763
• NM_002691.4:c.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_002691.4(POLD1):​c.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG​(p.Gly113_Pro123del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G113G) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: POLD1 NM_002691.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.35
• Publications: 0 publications found

Genes affected

POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]

POLD1 Gene-Disease associations (from GenCC):

• POLD1-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 10

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
• mandibular hypoplasia-deafness-progeroid syndrome

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, Orphanet, G2P
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• immunodeficiency 120

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• non-severe combined immunodeficiency due to polymerase delta deficiency

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002691.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLD1	NM_002691.4	c.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG	p.Gly113_Pro123del	disruptive_inframe_deletion	Exon 4 of 27	ENST00000440232.7	NP_002682.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLD1	ENST00000440232.7	c.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG	p.Gly113_Pro123del	disruptive_inframe_deletion	Exon 4 of 27	1	NM_002691.4	ENSP00000406046.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Colorectal cancer, susceptibility to, 10 Uncertain:1

Mar 13, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with POLD1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant, c.338_370del, results in the deletion of 11 amino acids of the POLD1 protein (p.Gly113_Pro123del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555789763; hg19: chr19-50905048;