NM_003041.4:c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC

Variant names:

• chr16-31489216-T-TCGGCGTGCCCAGCTTTCCTCTG
• rs987447860
• NM_003041.4:c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_003041.4(SLC5A2):​c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC​(p.His525ProfsTer49) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000373 in 1,610,198 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000026 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: SLC5A2 NM_003041.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 0.119
• Publications: 0 publications found

Genes affected

SLC5A2 (HGNC:11037): (solute carrier family 5 member 2) This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]

SLC5A2 Gene-Disease associations (from GenCC):

• familial renal glucosuria

  Inheritance: AD, SD, AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Ambry Genetics, Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-31489216-T-TCGGCGTGCCCAGCTTTCCTCTG is Pathogenic according to our data. Variant chr16-31489216-T-TCGGCGTGCCCAGCTTTCCTCTG is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 591299.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003041.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC5A2	NM_003041.4	MANE Select	c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC	p.His525ProfsTer49	frameshift	Exon 12 of 14	NP_003032.1	P31639-1
	SLC5A2	NR_130783.2		n.1246_1267dupCCAGCTTTCCTCTGCGGCGTGC		non_coding_transcript_exon	Exon 10 of 12

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC5A2	ENST00000330498.4	TSL:1 MANE Select	c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC	p.His525ProfsTer49	frameshift	Exon 12 of 14	ENSP00000327943.3	P31639-1
	SLC5A2	ENST00000419665.6	TSL:1	n.1232_1253dupCCAGCTTTCCTCTGCGGCGTGC		non_coding_transcript_exon	Exon 10 of 12	ENSP00000410601.2	P31639-2
	SLC5A2	ENST00000865380.1		c.1540_1561dupCCAGCTTTCCTCTGCGGCGTGC	p.His521ProfsTer49	frameshift	Exon 12 of 14	ENSP00000535439.1

Frequencies

GnomAD3 genomes AF: 0.0000263 AC: 4 AN: 152208 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000965

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1457990 Hom.: 0 Cov.: 33 AF XY: 0.00000276 AC XY: 2 AN XY: 725530

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.0000224 AC: 1 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111976

Other (OTH) AF: 0.0000166 AC: 1 AN: 60360

GnomAD4 genome AF: 0.0000263 AC: 4 AN: 152208 Hom.: 0 Cov.: 33 AF XY: 0.0000403 AC XY: 3 AN XY: 74362

African (AFR) AF: 0.0000965 AC: 4 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15288

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5184

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68040

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Familial renal glucosuria (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.12
Mutation Taster		=27/173	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs987447860; hg19: chr16-31500537;