NM_003242.6:c.-315_-23del
- chr3-30606568-CCCCCGCAGCGCTGAGTTGAAGTTGAGTGAGTCACTCGCGCGCACGGAGCGACGACACCCCCGCGCGTGCACCCGCTCGGGACAGGAGCCGGACTCCTGTGCAGCTTCCCTCGGCCGCCGGGGGCCTCCCCGCGCCTCGCCGGCCTCCAGGCCCCCTCCTGGCTGGCGAGCGGGCGCCACATCTGGCCCGCACATCTGCGCTGCCGGCCCGGCGCGGGGTCCGGAGAGGGCGCGGCGCGGAGGCGCAGCCAGGGGTCCGGGAAGGCGCCGTCCGCTGCGCTGGGGGCTCGGTCT-C
- NM_003242.6:c.-315_-23del
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_003242.6(TGFBR2):c.-315_-23del variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_003242.6 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- familial thoracic aortic aneurysm and aortic dissectionInheritance: AD, Unknown Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- Loeys-Dietz syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
- Loeys-Dietz syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003242.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TGFBR2 | TSL:1 MANE Select | c.-315_-23del | 5_prime_UTR | Exon 1 of 7 | ENSP00000295754.5 | P37173-1 | |||
| TGFBR2 | TSL:1 | c.-315_-23del | 5_prime_UTR | Exon 1 of 8 | ENSP00000351905.4 | P37173-2 | |||
| TGFBR2 | TSL:1 MANE Select | c.-315_-23del | non_coding_transcript | N/A | ENSP00000295754.5 | P37173-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at