NM_003242.6:c.-315_-23del

Variant names:

• chr3-30606568-CCCCCGCAGCGCTGAGTTGAAGTTGAGTGAGTCACTCGCGCGCACGGAGCGACGACACCCCCGCGCGTGCACCCGCTCGGGACAGGAGCCGGACTCCTGTGCAGCTTCCCTCGGCCGCCGGGGGCCTCCCCGCGCCTCGCCGGCCTCCAGGCCCCCTCCTGGCTGGCGAGCGGGCGCCACATCTGGCCCGCACATCTGCGCTGCCGGCCCGGCGCGGGGTCCGGAGAGGGCGCGGCGCGGAGGCGCAGCCAGGGGTCCGGGAAGGCGCCGTCCGCTGCGCTGGGGGCTCGGTCT-C
• NM_003242.6:c.-315_-23del

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_003242.6(TGFBR2):​c.-315_-23del variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TGFBR2 NM_003242.6 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.53

Genes affected

TGFBR2 (HGNC:11773): (transforming growth factor beta receptor 2) The protein encoded by this gene is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with TGF-beta receptor type-1, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of genes related to cell proliferation, cell cycle arrest, wound healing, immunosuppression, and tumorigenesis. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Aug 2017]

LOC105377015 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TGFBR2	NM_003242.6	c.-315_-23del		5_prime_UTR_variant	Exon 1 of 7	ENST00000295754.10	NP_003233.4
TGFBR2	NM_003242.6	c.-315_-23del		non_coding_transcript_variant		ENST00000295754.10	NP_003233.4
TGFBR2	NM_003242.6	c.-315_-23del		upstream_gene_variant		ENST00000295754.10	NP_003233.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TGFBR2	ENST00000295754	c.-315_-23del		5_prime_UTR_variant	Exon 1 of 7	1	NM_003242.6	ENSP00000295754.5
TGFBR2	ENST00000295754.10	c.-315_-23del		non_coding_transcript_variant		1	NM_003242.6	ENSP00000295754.5
TGFBR2	ENST00000295754.10	c.-315_-23del		upstream_gene_variant		1	NM_003242.6	ENSP00000295754.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial thoracic aortic aneurysm and aortic dissection Uncertain:1

Apr 14, 2022

CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-30648060;