NM_003265.3:c.106_129delGACTGCAGCCACCTGAAGTTGACT

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3

The NM_003265.3(TLR3):​c.106_129delGACTGCAGCCACCTGAAGTTGACT​(p.Asp36_Thr43del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

TLR3
NM_003265.3 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.24
Variant links:
Genes affected
TLR3 (HGNC:11849): (toll like receptor 3) The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It thus plays a role in host defense against multiple viruses. [provided by RefSeq, Jul 2021]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 5 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_003265.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TLR3NM_003265.3 linkc.106_129delGACTGCAGCCACCTGAAGTTGACT p.Asp36_Thr43del conservative_inframe_deletion Exon 2 of 5 ENST00000296795.8 NP_003256.1 O15455-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TLR3ENST00000296795.8 linkc.106_129delGACTGCAGCCACCTGAAGTTGACT p.Asp36_Thr43del conservative_inframe_deletion Exon 2 of 5 1 NM_003265.3 ENSP00000296795.3 O15455-1
TLR3ENST00000513189.1 linkn.106_129delGACTGCAGCCACCTGAAGTTGACT non_coding_transcript_exon_variant Exon 2 of 5 1 ENSP00000423386.1 D6RA51
TLR3ENST00000698351.1 linkc.106_129delGACTGCAGCCACCTGAAGTTGACT p.Asp36_Thr43del conservative_inframe_deletion Exon 2 of 5 ENSP00000513674.1 A0A8V8TLN9
TLR3ENST00000698352.1 linkn.106_129delGACTGCAGCCACCTGAAGTTGACT non_coding_transcript_exon_variant Exon 2 of 5 ENSP00000513675.1 A0A8V8TN43

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Herpes simplex encephalitis, susceptibility to, 1 Uncertain:1
Jul 19, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 1465072). This variant has not been reported in the literature in individuals affected with TLR3-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.106_129del, results in the deletion of 8 amino acid(s) of the TLR3 protein (p.Asp36_Thr43del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-186997876; API