NM_003361.4:c.529_555delCACCGCACCCTGGACGAGTACTGGCGC

Variant names:

• chr16-20348745-TGCGCCAGTACTCGTCCAGGGTGCGGTG-T
• rs1555487528
• NM_003361.4:c.529_555delCACCGCACCCTGGACGAGTACTGGCGC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1 PM4 PP5_Very_Strong

The NM_003361.4(UMOD):​c.529_555delCACCGCACCCTGGACGAGTACTGGCGC​(p.His177_Arg185del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: UMOD NM_003361.4 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5 O:1
• Conservation: PhyloP100: 5.81
• Publications: 1 publications found

Genes affected

UMOD (HGNC:12559): (uromodulin) The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

UMOD Gene-Disease associations (from GenCC):

• autosomal dominant medullary cystic kidney disease with or without hyperuricemia

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• glomerulocystic kidney disease with hyperuricemia and isosthenuria

  Inheritance: AD Classification: DEFINITIVE Submitted by: Laboratory for Molecular Medicine
• familial juvenile hyperuricemic nephropathy type 1

  Inheritance: AD, Unknown Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• autosomal dominant medullary cystic kidney disease with hyperuricemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PM1: In a hotspot region, there are 10 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 10 uncertain in NM_003361.4
• PM4: Nonframeshift variant in NON repetitive region in NM_003361.4.
• PP5: Variant 16-20348745-TGCGCCAGTACTCGTCCAGGGTGCGGTG-T is Pathogenic according to our data. Variant chr16-20348745-TGCGCCAGTACTCGTCCAGGGTGCGGTG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 12254.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
UMOD	NM_003361.4	c.529_555delCACCGCACCCTGGACGAGTACTGGCGC	p.His177_Arg185del	conservative_inframe_deletion	Exon 3 of 11	ENST00000396138.9	NP_003352.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
UMOD	ENST00000396138.9	c.529_555delCACCGCACCCTGGACGAGTACTGGCGC	p.His177_Arg185del	conservative_inframe_deletion	Exon 3 of 11	5	NM_003361.4	ENSP00000379442.5
UMOD	ENST00000396134.6	c.628_654delCACCGCACCCTGGACGAGTACTGGCGC	p.His210_Arg218del	conservative_inframe_deletion	Exon 4 of 12	2		ENSP00000379438.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:5 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial juvenile hyperuricemic nephropathy type 1 Pathogenic:2 Other:1

Dec 01, 2002

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Jan 03, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

Common pathogenic variant -

not provided Pathogenic:2

Oct 03, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.529_555del, results in the deletion of 9 amino acid(s) of the UMOD protein (p.His177_Arg185del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with familial juvenile hyperuricaemic nephropathy (PMID: 12471200). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 12254). For these reasons, this variant has been classified as Pathogenic. -

Jan 11, 2024

Athena Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has been identified in multiple unrelated individuals with clinical features associated with this gene, and segregates with disease in at least one family. This variant has not been reported in large, multi-ethnic general populations. (http://gnomad.broadinstitute.org) This variant occurs as the most likely explanation for disease in a significant number of internal cases, suggesting this variant is associated with disease. Assessment of experimental evidence suggests this variant results in abnormal protein function. (PMID: 16135773) -

UMOD-related disorder Pathogenic:1

Aug 16, 2024

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The UMOD c.529_555del27 variant is predicted to result in an in-frame deletion (p.His177_Arg185del). In a linkage mapping and sequencing study, this variant has been reported to completely segregate with disease in a large multigenerational family affected by familial juvenile hyperuricaemic nephropathy (Family 1 in Hart et al. 2002. PubMed ID: 12471200). In addition, this variant has also been reported in patients with UMOD-related diseases (Table S3 of Bleyer et al. 2022. PubMed ID: 35325889; Table S1 of Olinger et al. 2020. PubMed ID: 32450155; Wilson et al. 2020. PubMed ID: 35372954). In the ClinVar database, this variant has been interpreted as pathogenic (https://www.ncbi.nlm.nih.gov/clinvar/variation/12254/). This variant has not been reported in a large population database, indicating this variant is rare. This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.8
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555487528; hg19: chr16-20360067;