NM_003361.4:c.529_555delCACCGCACCCTGGACGAGTACTGGCGC

Variant names:

• chr16-20348745-TGCGCCAGTACTCGTCCAGGGTGCGGTG-T
• rs1555487528
• NM_003361.4:c.529_555delCACCGCACCCTGGACGAGTACTGGCGC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PS3 PM1 PM4 PP5_Very_Strong

The NM_003361.4(UMOD):​c.529_555delCACCGCACCCTGGACGAGTACTGGCGC​(p.His177_Arg185del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000616231: Assessment of experimental evidence suggests this variant results in abnormal protein function. (PMID:16135773)".

• Frequency: Genomes: not found (cov: 33)
• Consequence: UMOD NM_003361.4 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5 O:1
• Conservation: PhyloP100: 5.81
• Publications: 1 publications found

Genes affected

UMOD (HGNC:12559): (uromodulin) The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

UMOD Gene-Disease associations (from GenCC):

• autosomal dominant medullary cystic kidney disease with or without hyperuricemia

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• glomerulocystic kidney disease with hyperuricemia and isosthenuria

  Inheritance: AD Classification: DEFINITIVE Submitted by: Laboratory for Molecular Medicine
• familial juvenile hyperuricemic nephropathy type 1

  Inheritance: Unknown, AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• autosomal dominant medullary cystic kidney disease with hyperuricemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV000616231: Assessment of experimental evidence suggests this variant results in abnormal protein function. (PMID: 16135773)
• PM1: In a hotspot region, there are 11 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 10 uncertain in NM_003361.4
• PM4: Nonframeshift variant in NON repetitive region in NM_003361.4.
• PP5: Variant 16-20348745-TGCGCCAGTACTCGTCCAGGGTGCGGTG-T is Pathogenic according to our data. Variant chr16-20348745-TGCGCCAGTACTCGTCCAGGGTGCGGTG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 12254.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003361.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	UMOD	NM_003361.4	MANE Select	c.529_555delCACCGCACCCTGGACGAGTACTGGCGC	p.His177_Arg185del	conservative_inframe_deletion	Exon 3 of 11	NP_003352.2	P07911-1
	UMOD	NM_001378234.1		c.529_555delCACCGCACCCTGGACGAGTACTGGCGC	p.His177_Arg185del	conservative_inframe_deletion	Exon 3 of 12	NP_001365163.1
	UMOD	NM_001378235.1		c.529_555delCACCGCACCCTGGACGAGTACTGGCGC	p.His177_Arg185del	conservative_inframe_deletion	Exon 3 of 12	NP_001365164.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	UMOD	ENST00000396138.9	TSL:5 MANE Select	c.529_555delCACCGCACCCTGGACGAGTACTGGCGC	p.His177_Arg185del	conservative_inframe_deletion	Exon 3 of 11	ENSP00000379442.5	P07911-1
	UMOD	ENST00000396134.6	TSL:2	c.628_654delCACCGCACCCTGGACGAGTACTGGCGC	p.His210_Arg218del	conservative_inframe_deletion	Exon 4 of 12	ENSP00000379438.2	P07911-5
	UMOD	ENST00000863077.1		c.691_717delCACCGCACCCTGGACGAGTACTGGCGC	p.His231_Arg239del	conservative_inframe_deletion	Exon 4 of 12	ENSP00000533136.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Familial juvenile hyperuricemic nephropathy type 1 (3)
2	-	-	not provided (2)
1	-	-	UMOD-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.8
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555487528; hg19: chr16-20360067;