rs1555487528
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1PM4PP5_Very_Strong
The NM_003361.4(UMOD):c.529_555delCACCGCACCCTGGACGAGTACTGGCGC(p.His177_Arg185del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_003361.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant medullary cystic kidney disease with or without hyperuricemiaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- glomerulocystic kidney disease with hyperuricemia and isosthenuriaInheritance: AD Classification: DEFINITIVE Submitted by: Laboratory for Molecular Medicine
- familial juvenile hyperuricemic nephropathy type 1Inheritance: AD, Unknown Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
- autosomal dominant medullary cystic kidney disease with hyperuricemiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| UMOD | ENST00000396138.9 | c.529_555delCACCGCACCCTGGACGAGTACTGGCGC | p.His177_Arg185del | conservative_inframe_deletion | Exon 3 of 11 | 5 | NM_003361.4 | ENSP00000379442.5 | ||
| UMOD | ENST00000396134.6 | c.628_654delCACCGCACCCTGGACGAGTACTGGCGC | p.His210_Arg218del | conservative_inframe_deletion | Exon 4 of 12 | 2 | ENSP00000379438.2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Familial juvenile hyperuricemic nephropathy type 1 Pathogenic:2Other:1
- -
- -
Common pathogenic variant -
not provided Pathogenic:2
This variant, c.529_555del, results in the deletion of 9 amino acid(s) of the UMOD protein (p.His177_Arg185del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with familial juvenile hyperuricaemic nephropathy (PMID: 12471200). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 12254). For these reasons, this variant has been classified as Pathogenic. -
This variant has been identified in multiple unrelated individuals with clinical features associated with this gene, and segregates with disease in at least one family. This variant has not been reported in large, multi-ethnic general populations. (http://gnomad.broadinstitute.org) This variant occurs as the most likely explanation for disease in a significant number of internal cases, suggesting this variant is associated with disease. Assessment of experimental evidence suggests this variant results in abnormal protein function. (PMID: 16135773) -
UMOD-related disorder Pathogenic:1
The UMOD c.529_555del27 variant is predicted to result in an in-frame deletion (p.His177_Arg185del). In a linkage mapping and sequencing study, this variant has been reported to completely segregate with disease in a large multigenerational family affected by familial juvenile hyperuricaemic nephropathy (Family 1 in Hart et al. 2002. PubMed ID: 12471200). In addition, this variant has also been reported in patients with UMOD-related diseases (Table S3 of Bleyer et al. 2022. PubMed ID: 35325889; Table S1 of Olinger et al. 2020. PubMed ID: 32450155; Wilson et al. 2020. PubMed ID: 35372954). In the ClinVar database, this variant has been interpreted as pathogenic (https://www.ncbi.nlm.nih.gov/clinvar/variation/12254/). This variant has not been reported in a large population database, indicating this variant is rare. This variant is interpreted as pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at