NM_003502.4:c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC

Variant names:

• chr16-309972-CGGGAATGTGAGGTAGGGGCACCCGCCCATTGA-C
• rs587776627
• NM_003502.4:c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_003502.4(AXIN1):​c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC​(p.Val362fs) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: AXIN1 NM_003502.4 frameshift, splice_region
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.62
• Publications: 1 publications found

Genes affected

AXIN1 (HGNC:903): (axin 1) This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

AXIN1 Gene-Disease associations (from GenCC):

• caudal duplication

  Inheritance: AD Classification: LIMITED Submitted by: G2P
• colorectal adenoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-309972-CGGGAATGTGAGGTAGGGGCACCCGCCCATTGA-C is Pathogenic according to our data. Variant chr16-309972-CGGGAATGTGAGGTAGGGGCACCCGCCCATTGA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 6037.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AXIN1	NM_003502.4	c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC	p.Val362fs	frameshift_variant, splice_region_variant	Exon 4 of 11	ENST00000262320.8	NP_003493.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AXIN1	ENST00000262320.8	c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC	p.Val362fs	frameshift_variant, splice_region_variant	Exon 4 of 11	1	NM_003502.4	ENSP00000262320.3
AXIN1	ENST00000354866.7	c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC	p.Val362fs	frameshift_variant, splice_region_variant	Exon 4 of 10	1		ENSP00000346935.3
AXIN1	ENST00000461023.5	n.382_413delTCAATGGGCGGGTGCCCCTACCTCACATTCCC		splice_region_variant, non_coding_transcript_exon_variant	Exon 3 of 8	2
AXIN1	ENST00000481769.1	n.512_543delTCAATGGGCGGGTGCCCCTACCTCACATTCCC		splice_region_variant, non_coding_transcript_exon_variant	Exon 3 of 5	3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Hepatocellular carcinoma Pathogenic:1

Mar 01, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776627; hg19: chr16-359972;