rs587776627

Variant names:

• chr16-309972-CGGGAATGTGAGGTAGGGGCACCCGCCCATTGA-C
• rs587776627
• NM_003502.4:c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_003502.4(AXIN1):​c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC​(p.Val362fs) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: AXIN1 NM_003502.4 frameshift, splice_region
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.62

Genes affected

AXIN1 (HGNC:903): (axin 1) This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-309972-CGGGAATGTGAGGTAGGGGCACCCGCCCATTGA-C is Pathogenic according to our data. Variant chr16-309972-CGGGAATGTGAGGTAGGGGCACCCGCCCATTGA-C is described in ClinVar as [Pathogenic]. Clinvar id is 6037.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AXIN1	NM_003502.4	c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC	p.Val362fs	frameshift_variant, splice_region_variant	Exon 4 of 11	ENST00000262320.8	NP_003493.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AXIN1	ENST00000262320.8	c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC	p.Val362fs	frameshift_variant, splice_region_variant	Exon 4 of 11	1	NM_003502.4	ENSP00000262320.3
AXIN1	ENST00000354866.7	c.1085_1116delTCAATGGGCGGGTGCCCCTACCTCACATTCCC	p.Val362fs	frameshift_variant, splice_region_variant	Exon 4 of 10	1		ENSP00000346935.3
AXIN1	ENST00000461023.5	n.382_413delTCAATGGGCGGGTGCCCCTACCTCACATTCCC		splice_region_variant, non_coding_transcript_exon_variant	Exon 3 of 8	2
AXIN1	ENST00000481769.1	n.512_543delTCAATGGGCGGGTGCCCCTACCTCACATTCCC		splice_region_variant, non_coding_transcript_exon_variant	Exon 3 of 5	3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Hepatocellular carcinoma Pathogenic:1

Mar 01, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587776627; hg19: chr16-359972;