NM_003924.4:c.738_761delGGCCGCGGCAGCGGCGGCGGCGGC

Variant names:

• chr4-41745990-TGCCGCCGCCGCCGCTGCCGCGGCC-T
• rs749694204
• NM_003924.4:c.738_761delGGCCGCGGCAGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_003924.4(PHOX2B):​c.738_761delGGCCGCGGCAGCGGCGGCGGCGGC​(p.Ala247_Ala254del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000147 in 1,089,222 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A246A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.000015 (1 hom.)
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.12
• Publications: 0 publications found

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

PHOX2B Gene-Disease associations (from GenCC):

• central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), G2P
• Haddad syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• neuroblastoma, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
• congenital central hypoventilation syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003924.4
• BS2: High AC in GnomAdExome4 at 16 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003924.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PHOX2B	NM_003924.4	MANE Select	c.738_761delGGCCGCGGCAGCGGCGGCGGCGGC	p.Ala247_Ala254del	disruptive_inframe_deletion	Exon 3 of 3	NP_003915.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PHOX2B	ENST00000226382.4	TSL:1 MANE Select	c.738_761delGGCCGCGGCAGCGGCGGCGGCGGC	p.Ala247_Ala254del	disruptive_inframe_deletion	Exon 3 of 3	ENSP00000226382.2	Q99453
	PHOX2B	ENST00000510424.2	TSL:3	n.*19_*42delGGCCGCGGCAGCGGCGGCGGCGGC		downstream_gene	N/A

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.0000147 AC: 16 AN: 1089222 Hom.: 1 AF XY: 0.0000153 AC XY: 8 AN XY: 522656

African (AFR) AF: 0.00 AC: 0 AN: 22026

American (AMR) AF: 0.00 AC: 0 AN: 8376

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 14028

East Asian (EAS) AF: 0.00 AC: 0 AN: 24026

South Asian (SAS) AF: 0.0000855 AC: 2 AN: 23382

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 27446

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2978

European-Non Finnish (NFE) AF: 0.0000151 AC: 14 AN: 924342

Other (OTH) AF: 0.00 AC: 0 AN: 42618

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs749694204; hg19: chr4-41748007;