NM_004004.6:c.77_106dupCCGTCCTCTTCATTTTTCGCATTATGATCC

Variant names:

• chr13-20189475-A-AGGATCATAATGCGAAAAATGAAGAGGACGG
• rs398123815
• NM_004004.6:c.77_106dupCCGTCCTCTTCATTTTTCGCATTATGATCC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_004004.6(GJB2):​c.77_106dupCCGTCCTCTTCATTTTTCGCATTATGATCC​(p.Ile35_Leu36insProValLeuPheIlePheArgIleMetIle) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. L36L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: GJB2 NM_004004.6 conservative_inframe_insertion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 5.01
• Publications: 0 publications found

Genes affected

GJB2 (HGNC:4284): (gap junction protein beta 2) This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]

GJB2 Gene-Disease associations (from GenCC):

• Bart-Pumphrey syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P
• ichthyosis, hystrix-like, with hearing loss

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• keratoderma hereditarium mutilans

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P
• palmoplantar keratoderma-deafness syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
• autosomal recessive nonsyndromic hearing loss 1A

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, G2P, PanelApp Australia
• hearing loss, autosomal recessive

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• autosomal dominant keratitis-ichthyosis-hearing loss syndrome

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Ambry Genetics
• autosomal dominant nonsyndromic hearing loss 3A

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• autosomal dominant nonsyndromic hearing loss

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• KID syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000296095 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 22 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 5 uncertain in NM_004004.6
• PM4: Nonframeshift variant in NON repetitive region in NM_004004.6.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004004.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJB2	NM_004004.6	MANE Select	c.77_106dupCCGTCCTCTTCATTTTTCGCATTATGATCC	p.Ile35_Leu36insProValLeuPheIlePheArgIleMetIle	conservative_inframe_insertion	Exon 2 of 2	NP_003995.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJB2	ENST00000382848.5	TSL:1 MANE Select	c.77_106dupCCGTCCTCTTCATTTTTCGCATTATGATCC	p.Ile35_Leu36insProValLeuPheIlePheArgIleMetIle	conservative_inframe_insertion	Exon 2 of 2	ENSP00000372299.4
	GJB2	ENST00000382844.2	TSL:6	c.77_106dupCCGTCCTCTTCATTTTTCGCATTATGATCC	p.Ile35_Leu36insProValLeuPheIlePheArgIleMetIle	conservative_inframe_insertion	Exon 1 of 1	ENSP00000372295.1
	GJB2	ENST00000906230.1		c.77_106dupCCGTCCTCTTCATTTTTCGCATTATGATCC	p.Ile35_Leu36insProValLeuPheIlePheArgIleMetIle	conservative_inframe_insertion	Exon 2 of 2	ENSP00000576289.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs398123815; hg19: chr13-20763614;