NM_004260.4:c.14_34delGGGACGTGCGGGAGCGGCTGC

Variant names:

• chr8-144517750-TGCAGCCGCTCCCGCACGTCCC-T
• rs1445577376
• NM_004260.4:c.14_34delGGGACGTGCGGGAGCGGCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_004260.4(RECQL4):​c.14_34delGGGACGTGCGGGAGCGGCTGC​(p.Arg5_Leu11del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000369 in 1,328,328 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R5R) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 34)
  • Exomes 𝑓: 0.000041 (0 hom.)
• Consequence: RECQL4 NM_004260.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.27
• Publications: 0 publications found

Genes affected

RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]

LRRC14 (HGNC:20419): (leucine rich repeat containing 14) This gene encodes a leucine-rich repeat-containing protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004260.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004260.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RECQL4	NM_004260.4	MANE Select	c.14_34delGGGACGTGCGGGAGCGGCTGC	p.Arg5_Leu11del	disruptive_inframe_deletion	Exon 1 of 21	NP_004251.4	O94761
	RECQL4	NM_001413019.1		c.14_34delGGGACGTGCGGGAGCGGCTGC	p.Arg5_Leu11del	disruptive_inframe_deletion	Exon 1 of 20	NP_001399948.1
	RECQL4	NM_001413036.1		c.14_34delGGGACGTGCGGGAGCGGCTGC	p.Arg5_Leu11del	disruptive_inframe_deletion	Exon 1 of 21	NP_001399965.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RECQL4	ENST00000617875.6	TSL:1 MANE Select	c.14_34delGGGACGTGCGGGAGCGGCTGC	p.Arg5_Leu11del	disruptive_inframe_deletion	Exon 1 of 21	ENSP00000482313.2	O94761
	RECQL4	ENST00000621189.4	TSL:1	c.-1123_-1103delGGGACGTGCGGGAGCGGCTGC		5_prime_UTR	Exon 1 of 20	ENSP00000483145.1	A0A087X072
	RECQL4	ENST00000971710.1		c.14_34delGGGACGTGCGGGAGCGGCTGC	p.Arg5_Leu11del	disruptive_inframe_deletion	Exon 1 of 21	ENSP00000641769.1

Frequencies

GnomAD3 genomes AF: 0.00000663 AC: 1 AN: 150744 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.0000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000284 AC: 1 AN: 35252 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000754

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000408 AC: 48 AN: 1177584 Hom.: 0 AF XY: 0.0000331 AC XY: 19 AN XY: 574186

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000426 AC: 1 AN: 23490

American (AMR) AF: 0.00 AC: 0 AN: 16016

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 17876

East Asian (EAS) AF: 0.00 AC: 0 AN: 25034

South Asian (SAS) AF: 0.0000207 AC: 1 AN: 48296

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 26728

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3272

European-Non Finnish (NFE) AF: 0.0000454 AC: 44 AN: 969792

Other (OTH) AF: 0.0000425 AC: 2 AN: 47080

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000663 AC: 1 AN: 150744 Hom.: 0 Cov.: 34 AF XY: 0.0000136 AC XY: 1 AN XY: 73574

African (AFR) AF: 0.0000242 AC: 1 AN: 41238

American (AMR) AF: 0.00 AC: 0 AN: 15144

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.00 AC: 0 AN: 5148

South Asian (SAS) AF: 0.00 AC: 0 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10092

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67540

Other (OTH) AF: 0.00 AC: 0 AN: 2068

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Baller-Gerold syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=113/87	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1445577376; hg19: chr8-145743134;