NM_004484.4:c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA

Variant names:

• chrX-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG
• rs1556297749
• NM_004484.4:c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004484.4(GPC3):​c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA​(p.Asn210ThrfsTer11) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: GPC3 NM_004484.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.60
• Publications: 0 publications found

Genes affected

GPC3 (HGNC:4451): (glypican 3) Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

GPC3 Gene-Disease associations (from GenCC):

• Simpson-Golabi-Behmel syndrome

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Simpson-Golabi-Behmel syndrome type 1

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is Pathogenic according to our data. Variant chrX-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is described in ClinVar as Pathogenic. ClinVar VariationId is 476661.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004484.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GPC3	NM_004484.4	MANE Select	c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn210ThrfsTer11	frameshift missense	Exon 3 of 8	NP_004475.1
	GPC3	NM_001164617.2		c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn210ThrfsTer11	frameshift missense	Exon 3 of 9	NP_001158089.1
	GPC3	NM_001164618.2		c.581_606delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn194ThrfsTer11	frameshift missense	Exon 3 of 8	NP_001158090.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GPC3	ENST00000370818.8	TSL:1 MANE Select	c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn210ThrfsTer11	frameshift missense	Exon 3 of 8	ENSP00000359854.3
	GPC3	ENST00000394299.7	TSL:1	c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn210ThrfsTer11	frameshift missense	Exon 3 of 9	ENSP00000377836.2
	GPC3	ENST00000631057.2	TSL:1	c.467_492delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn156ThrfsTer11	frameshift missense	Exon 2 of 7	ENSP00000486325.1

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Wilms tumor 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1556297749; hg19: chrX-132887887;