NM_004484.4:c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_004484.4(GPC3):​c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA​(p.Asn210ThrfsTer11) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 22)

Consequence

GPC3
NM_004484.4 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.60
Variant links:
Genes affected
GPC3 (HGNC:4451): (glypican 3) Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is Pathogenic according to our data. Variant chrX-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is described in ClinVar as [Pathogenic]. Clinvar id is 476661.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
GPC3NM_004484.4 linkc.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA p.Asn210ThrfsTer11 frameshift_variant, missense_variant Exon 3 of 8 ENST00000370818.8 NP_004475.1 P51654-1Q53H15I6QTG3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
GPC3ENST00000370818.8 linkc.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA p.Asn210ThrfsTer11 frameshift_variant, missense_variant Exon 3 of 8 1 NM_004484.4 ENSP00000359854.3 P51654-1

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Wilms tumor 1 Pathogenic:1
Mar 13, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in GPC3 are known to be pathogenic (PMID: 10814714, 17603795). This sequence change deletes 26 nucleotides and inserts 6 nucleotides in exon 3 of the GPC3 mRNA (c.629_654delinsCTTGCA), causing a frameshift at codon 210. This creates a premature translational stop signal (p.Asn210Thrfs*11) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1556297749; hg19: chrX-132887887; API