rs1556297749

Variant names:

• chrX-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG
• rs1556297749
• NM_004484.4:c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_004484.4(GPC3):​c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA​(p.Asn210ThrfsTer11) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: GPC3 NM_004484.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.60

Genes affected

GPC3 (HGNC:4451): (glypican 3) Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is Pathogenic according to our data. Variant chrX-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is described in ClinVar as [Pathogenic]. Clinvar id is 476661.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GPC3	NM_004484.4	c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn210ThrfsTer11	frameshift_variant, missense_variant	Exon 3 of 8	ENST00000370818.8	NP_004475.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GPC3	ENST00000370818.8	c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA	p.Asn210ThrfsTer11	frameshift_variant, missense_variant	Exon 3 of 8	1	NM_004484.4	ENSP00000359854.3

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Wilms tumor 1 Pathogenic:1

Mar 13, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in GPC3 are known to be pathogenic (PMID: 10814714, 17603795). This sequence change deletes 26 nucleotides and inserts 6 nucleotides in exon 3 of the GPC3 mRNA (c.629_654delinsCTTGCA), causing a frameshift at codon 210. This creates a premature translational stop signal (p.Asn210Thrfs*11) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556297749; hg19: chrX-132887887;