NM_005222.4:c.105_128delGCAGCAGCAGCAGCAGCAACAGCA

Variant names:

• chr7-97006052-GCAGCAGCAGCAGCAGCAGCAGCAA-G
• rs775320932
• NM_005222.4:c.105_128delGCAGCAGCAGCAGCAGCAACAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_005222.4(DLX6):​c.105_128delGCAGCAGCAGCAGCAGCAACAGCA​(p.Gln36_Gln43del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000235 in 1,531,576 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. Q35Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00032 (0 hom., cov: 29)
  • Exomes 𝑓: 0.00023 (0 hom.)
• Consequence: DLX6 NM_005222.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 6.66
• Publications: 0 publications found

Genes affected

DLX6 (HGNC:2919): (distal-less homeobox 6) This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]

DLX6-AS1 (HGNC:37151): (DLX6 antisense RNA 1) Predicted to act upstream of or within positive regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_005222.4
• BS2: High AC in GnomAd4 at 48 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005222.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DLX6	NM_005222.4	MANE Select	c.105_128delGCAGCAGCAGCAGCAGCAACAGCA	p.Gln36_Gln43del	disruptive_inframe_deletion	Exon 1 of 3	NP_005213.3
	DLX6-AS1	NR_015448.1		n.141+7849_141+7872delTTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DLX6	ENST00000518156.3	TSL:1 MANE Select	c.105_128delGCAGCAGCAGCAGCAGCAACAGCA	p.Gln36_Gln43del	disruptive_inframe_deletion	Exon 1 of 3	ENSP00000428480.2	P56179-3
	DLX6-AS1	ENST00000458352.5	TSL:1	n.615+5749_615+5772delTTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A
	DLX6-AS1	ENST00000430027.3	TSL:2	n.141+7849_141+7872delTTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.000322 AC: 48 AN: 149224 Hom.: 0 Cov.: 29

Gnomad AFR AF: 0.000446

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000200

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000200

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000994

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000372

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000105 AC: 18 AN: 170816 AF XY: 0.000107

Gnomad AFR exome AF: 0.000241

Gnomad AMR exome AF: 0.000189

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000828

Gnomad FIN exome AF: 0.000125

Gnomad NFE exome AF: 0.0000703

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000226 AC: 312 AN: 1382352 Hom.: 0 AF XY: 0.000238 AC XY: 163 AN XY: 683622

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000226 AC: 7 AN: 31010

American (AMR) AF: 0.000325 AC: 12 AN: 36884

Ashkenazi Jewish (ASJ) AF: 0.0000407 AC: 1 AN: 24598

East Asian (EAS) AF: 0.000171 AC: 6 AN: 35078

South Asian (SAS) AF: 0.000180 AC: 14 AN: 77582

European-Finnish (FIN) AF: 0.0000668 AC: 3 AN: 44904

Middle Eastern (MID) AF: 0.000358 AC: 2 AN: 5588

European-Non Finnish (NFE) AF: 0.000238 AC: 255 AN: 1069690

Other (OTH) AF: 0.000210 AC: 12 AN: 57018

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000322 AC: 48 AN: 149224 Hom.: 0 Cov.: 29 AF XY: 0.000288 AC XY: 21 AN XY: 72834

African (AFR) AF: 0.000446 AC: 18 AN: 40386

American (AMR) AF: 0.000200 AC: 3 AN: 15034

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3446

East Asian (EAS) AF: 0.000200 AC: 1 AN: 4996

South Asian (SAS) AF: 0.00 AC: 0 AN: 4746

European-Finnish (FIN) AF: 0.0000994 AC: 1 AN: 10062

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 306

European-Non Finnish (NFE) AF: 0.000372 AC: 25 AN: 67284

Other (OTH) AF: 0.00 AC: 0 AN: 2052

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.7
Mutation Taster		=41/159	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs775320932; hg19: chr7-96635364;