NM_005263.5:c.115+10_115+29dupGCGCGCGGGCCAGGCGGGGC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_005263.5(GFI1):c.115+10_115+29dupGCGCGCGGGCCAGGCGGGGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_005263.5 intron
Scores
Clinical Significance
Conservation
Publications
- neutropenia, severe congenital, 2, autosomal dominantInheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- severe congenital neutropeniaInheritance: AD Classification: MODERATE Submitted by: Illumina
- autosomal dominant severe congenital neutropeniaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005263.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GFI1 | MANE Select | c.115+10_115+29dupGCGCGCGGGCCAGGCGGGGC | intron | N/A | NP_005254.2 | Q99684 | |||
| GFI1 | c.115+10_115+29dupGCGCGCGGGCCAGGCGGGGC | intron | N/A | NP_001120687.1 | Q99684 | ||||
| GFI1 | c.115+10_115+29dupGCGCGCGGGCCAGGCGGGGC | intron | N/A | NP_001120688.1 | Q99684 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GFI1 | TSL:2 MANE Select | c.115+29_115+30insGCGCGCGGGCCAGGCGGGGC | intron | N/A | ENSP00000294702.5 | Q99684 | |||
| GFI1 | TSL:1 | c.115+29_115+30insGCGCGCGGGCCAGGCGGGGC | intron | N/A | ENSP00000359357.1 | Q99684 | |||
| GFI1 | TSL:1 | c.115+29_115+30insGCGCGCGGGCCAGGCGGGGC | intron | N/A | ENSP00000399719.1 | Q99684 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 15
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at