NM_005462.5:c.631_840del

Variant names:

• chrX-141906015-GCTCCTTCTCCTCCACTTTATTGAGTATTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTCCTCTCCAGATTCCTGTGAGCCCCTCCTCCTCCTCCACTTTACTGAGTCTTTTCCAGAGTTTCTCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTTCTCTCCAGATTCCTGTGAGCCC-G
• rs1569477350
• NM_005462.5:c.631_840del

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 2P and 6B. PM4 BP6_Moderate BS2

The NM_005462.5(MAGEC1):​c.631_840del​(p.Leu211_Leu280del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00578 in 107,519 control chromosomes in the GnomAD database, including 1 homozygotes. There are 26 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0058 (1 hom., 26 hem., cov: 34)
  • Exomes 𝑓: 0.0046 (56 hom. 1564 hem.)
  • Failed GnomAD Quality Control
• Consequence: MAGEC1 NM_005462.5 conservative_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.77
• Publications: 0 publications found

Genes affected

MAGEC1 (HGNC:6812): (MAGE family member C1) This gene is a member of the melanoma antigen gene (MAGE) family. The proteins of this family are tumor-specific antigens that can be recognized by autologous cytolytic T lymphocytes. This protein contains a large number of unique short repetitive sequences in front of the MAGE-homologous sequence, and therefore is about 800 aa longer than the other MAGE proteins. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_005462.5.
• BP6: Variant X-141906015-GCTCCTTCTCCTCCACTTTATTGAGTATTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTCCTCTCCAGATTCCTGTGAGCCCCTCCTCCTCCTCCACTTTACTGAGTCTTTTCCAGAGTTTCTCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTTCTCTCCAGATTCCTGTGAGCCC-G is Benign according to our data. Variant chrX-141906015-GCTCCTTCTCCTCCACTTTATTGAGTATTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTCCTCTCCAGATTCCTGTGAGCCCCTCCTCCTCCTCCACTTTACTGAGTCTTTTCCAGAGTTTCTCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTTCTCTCCAGATTCCTGTGAGCCC-G is described in ClinVar as Likely_benign. ClinVar VariationId is 2661554.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Hemizygotes in GnomAd4 at 26 gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005462.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAGEC1	NM_005462.5	MANE Select	c.631_840del	p.Leu211_Leu280del	conservative_inframe_deletion	Exon 4 of 4	NP_005453.2	O60732-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAGEC1	ENST00000285879.5	TSL:1 MANE Select	c.631_840del	p.Leu211_Leu280del	conservative_inframe_deletion	Exon 4 of 4	ENSP00000285879.4	O60732-1
	MAGEC1	ENST00000406005.2	TSL:1	c.-115+488_-115+697del		intron	N/A	ENSP00000385500.2	O60732-2

Frequencies

GnomAD3 genomes AF: 0.00579 AC: 622 AN: 107468 Hom.: 1 Cov.: 34

Gnomad AFR AF: 0.000881

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00487

Gnomad ASJ AF: 0.0281

Gnomad EAS AF: 0.000330

Gnomad SAS AF: 0.00116

Gnomad FIN AF: 0.00185

Gnomad MID AF: 0.0145

Gnomad NFE AF: 0.00872

Gnomad OTH AF: 0.00559

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00465 AC: 5038 AN: 1084562 Hom.: 56 AF XY: 0.00436 AC XY: 1564 AN XY: 358672

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000779 AC: 20 AN: 25668

American (AMR) AF: 0.00363 AC: 120 AN: 33027

Ashkenazi Jewish (ASJ) AF: 0.0232 AC: 444 AN: 19164

East Asian (EAS) AF: 0.0000724 AC: 2 AN: 27627

South Asian (SAS) AF: 0.000804 AC: 43 AN: 53470

European-Finnish (FIN) AF: 0.00144 AC: 58 AN: 40379

Middle Eastern (MID) AF: 0.00464 AC: 19 AN: 4098

European-Non Finnish (NFE) AF: 0.00492 AC: 4116 AN: 835829

Other (OTH) AF: 0.00477 AC: 216 AN: 45300

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00578 AC: 621 AN: 107519 Hom.: 1 Cov.: 34 AF XY: 0.000796 AC XY: 26 AN XY: 32671

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000879 AC: 26 AN: 29574

American (AMR) AF: 0.00487 AC: 48 AN: 9859

Ashkenazi Jewish (ASJ) AF: 0.0281 AC: 71 AN: 2531

East Asian (EAS) AF: 0.000331 AC: 1 AN: 3022

South Asian (SAS) AF: 0.00116 AC: 3 AN: 2583

European-Finnish (FIN) AF: 0.00185 AC: 11 AN: 5933

Middle Eastern (MID) AF: 0.0161 AC: 3 AN: 186

European-Non Finnish (NFE) AF: 0.00870 AC: 450 AN: 51738

Other (OTH) AF: 0.00551 AC: 8 AN: 1451

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00112 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8
Mutation Taster		=198/2	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1569477350; hg19: chrX-140993801;