NM_006015.6:c.921_940delCTACCAGGGCTACCCCGGGG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_006015.6(ARID1A):​c.921_940delCTACCAGGGCTACCCCGGGG​(p.Tyr308ArgfsTer85) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. G307G) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

ARID1A
NM_006015.6 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 4.62
Variant links:
Genes affected
ARID1A (HGNC:11110): (AT-rich interaction domain 1A) This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 1-26697316-GCCCGGGGCTACCAGGGCTAC-G is Pathogenic according to our data. Variant chr1-26697316-GCCCGGGGCTACCAGGGCTAC-G is described in ClinVar as [Pathogenic]. Clinvar id is 434335.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ARID1ANM_006015.6 linkc.921_940delCTACCAGGGCTACCCCGGGG p.Tyr308ArgfsTer85 frameshift_variant Exon 1 of 20 ENST00000324856.13 NP_006006.3 O14497-1
ARID1ANM_139135.4 linkc.921_940delCTACCAGGGCTACCCCGGGG p.Tyr308ArgfsTer85 frameshift_variant Exon 1 of 20 NP_624361.1 O14497-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ARID1AENST00000324856.13 linkc.921_940delCTACCAGGGCTACCCCGGGG p.Tyr308ArgfsTer85 frameshift_variant Exon 1 of 20 1 NM_006015.6 ENSP00000320485.7 O14497-1
ARID1AENST00000457599.6 linkc.921_940delCTACCAGGGCTACCCCGGGG p.Tyr308ArgfsTer85 frameshift_variant Exon 1 of 20 5 ENSP00000387636.2 O14497-2
ARID1AENST00000430799.7 linkc.-13+3707_-13+3726delCTACCAGGGCTACCCCGGGG intron_variant Intron 1 of 19 5 ENSP00000390317.3 H0Y488
ARID1AENST00000637465.1 linkc.-13+1224_-13+1243delCTACCAGGGCTACCCCGGGG intron_variant Intron 1 of 2 5 ENSP00000490650.1 A0A1B0GVT5

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Intellectual disability, autosomal dominant 14 Pathogenic:1
Jun 08, 2016
Genetic Services Laboratory, University of Chicago
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553146165; hg19: chr1-27023807; API