NM_006015.6:c.921_940delCTACCAGGGCTACCCCGGGG

Variant names:

• chr1-26697316-GCCCGGGGCTACCAGGGCTAC-G
• rs1553146165
• NM_006015.6:c.921_940delCTACCAGGGCTACCCCGGGG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_006015.6(ARID1A):​c.921_940delCTACCAGGGCTACCCCGGGG​(p.Tyr308ArgfsTer85) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. G307G) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ARID1A NM_006015.6 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.62
• Publications: 0 publications found

Genes affected

ARID1A (HGNC:11110): (AT-rich interaction domain 1A) This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ARID1A Gene-Disease associations (from GenCC):

• Coffin-Siris syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• intellectual disability, autosomal dominant 14

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Illumina, G2P, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-26697316-GCCCGGGGCTACCAGGGCTAC-G is Pathogenic according to our data. Variant chr1-26697316-GCCCGGGGCTACCAGGGCTAC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 434335.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARID1A	NM_006015.6	c.921_940delCTACCAGGGCTACCCCGGGG	p.Tyr308ArgfsTer85	frameshift_variant	Exon 1 of 20	ENST00000324856.13	NP_006006.3
ARID1A	NM_139135.4	c.921_940delCTACCAGGGCTACCCCGGGG	p.Tyr308ArgfsTer85	frameshift_variant	Exon 1 of 20		NP_624361.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARID1A	ENST00000324856.13	c.921_940delCTACCAGGGCTACCCCGGGG	p.Tyr308ArgfsTer85	frameshift_variant	Exon 1 of 20	1	NM_006015.6	ENSP00000320485.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, autosomal dominant 14 Pathogenic:1

Jun 08, 2016

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.6
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553146165; hg19: chr1-27023807;