rs1553146165

Positions:

• chr1-26697316-GCCCGGGGCTACCAGGGCTAC-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_006015.6(ARID1A):​c.921_940delCTACCAGGGCTACCCCGGGG​(p.Tyr308fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ARID1A NM_006015.6 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.62

Genes affected

ARID1A (HGNC:11110): (AT-rich interaction domain 1A) This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-26697316-GCCCGGGGCTACCAGGGCTAC-G is Pathogenic according to our data. Variant chr1-26697316-GCCCGGGGCTACCAGGGCTAC-G is described in ClinVar as [Pathogenic]. Clinvar id is 434335.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ARID1A	NM_006015.6	c.921_940delCTACCAGGGCTACCCCGGGG	p.Tyr308fs	frameshift_variant	1/20	ENST00000324856.13	NP_006006.3
ARID1A	NM_139135.4	c.921_940delCTACCAGGGCTACCCCGGGG	p.Tyr308fs	frameshift_variant	1/20		NP_624361.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ARID1A	ENST00000324856.13	c.921_940delCTACCAGGGCTACCCCGGGG	p.Tyr308fs	frameshift_variant	1/20	1	NM_006015.6	ENSP00000320485.7
ARID1A	ENST00000457599.6	c.921_940delCTACCAGGGCTACCCCGGGG	p.Tyr308fs	frameshift_variant	1/20	5		ENSP00000387636.2
ARID1A	ENST00000430799.7	c.-13+3707_-13+3726delCTACCAGGGCTACCCCGGGG		intron_variant		5		ENSP00000390317.3
ARID1A	ENST00000637465.1	c.-13+1224_-13+1243delCTACCAGGGCTACCCCGGGG		intron_variant		5		ENSP00000490650.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, autosomal dominant 14 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Jun 08, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553146165; hg19: chr1-27023807;