rs1553146165
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_006015.6(ARID1A):c.921_940delCTACCAGGGCTACCCCGGGG(p.Tyr308ArgfsTer85) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. G307G) has been classified as Benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_006015.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- intellectual disability, autosomal dominant 14Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Illumina, G2P
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006015.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARID1A | TSL:1 MANE Select | c.921_940delCTACCAGGGCTACCCCGGGG | p.Tyr308ArgfsTer85 | frameshift | Exon 1 of 20 | ENSP00000320485.7 | O14497-1 | ||
| ARID1A | c.921_940delCTACCAGGGCTACCCCGGGG | p.Tyr308ArgfsTer85 | frameshift | Exon 1 of 20 | ENSP00000520984.1 | A0ABJ7H312 | |||
| ARID1A | TSL:5 | c.921_940delCTACCAGGGCTACCCCGGGG | p.Tyr308ArgfsTer85 | frameshift | Exon 1 of 20 | ENSP00000387636.2 | O14497-2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.