NM_006079.5:c.510_536dupGGGCGGCAGCAGCACCCCCGGCGGCTC

Variant names:

• chr6-139373408-A-AGAGCCGCCGGGGGTGCTGCTGCCGCCC
• rs779637348
• NM_006079.5:c.510_536dupGGGCGGCAGCAGCACCCCCGGCGGCTC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP3 BS2_Supporting

The NM_006079.5(CITED2):​c.510_536dupGGGCGGCAGCAGCACCCCCGGCGGCTC​(p.Ser179_Gly180insGlyGlySerSerThrProGlyGlySer) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000027 in 1,553,708 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000026 (0 hom.)
• Consequence: CITED2 NM_006079.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:2
• Conservation: PhyloP100: 2.07
• Publications: 0 publications found

Genes affected

CITED2 (HGNC:1987): (Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2) The protein encoded by this gene inhibits transactivation of HIF1A-induced genes by competing with binding of hypoxia-inducible factor 1-alpha to p300-CH1. Mutations in this gene are a cause of cardiac septal defects. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]

CITED2 Gene-Disease associations (from GenCC):

• atrial septal defect 8

  Inheritance: AD Classification: MODERATE Submitted by: Laboratory for Molecular Medicine
• congenital heart defects, multiple types

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• congenital heart disease

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• ventricular septal defect 2

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000226571 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_006079.5
• BS2: High AC in GnomAd4 at 5 AD,Unknown gene. Variant has AC lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006079.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CITED2	NM_006079.5	MANE Select	c.510_536dupGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Ser179_Gly180insGlyGlySerSerThrProGlyGlySer	disruptive_inframe_insertion	Exon 2 of 2	NP_006070.2
	CITED2	NM_001168389.3		c.525_551dupGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Ser184_Gly185insGlyGlySerSerThrProGlyGlySer	disruptive_inframe_insertion	Exon 2 of 2	NP_001161861.2	A0A0A0MTM3
	CITED2	NM_001168388.3		c.510_536dupGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Ser179_Gly180insGlyGlySerSerThrProGlyGlySer	disruptive_inframe_insertion	Exon 2 of 2	NP_001161860.1	Q99967-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CITED2	ENST00000367651.4	TSL:1 MANE Select	c.510_536dupGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Ser179_Gly180insGlyGlySerSerThrProGlyGlySer	disruptive_inframe_insertion	Exon 2 of 2	ENSP00000356623.2	Q99967-1
	CITED2	ENST00000537332.2	TSL:3	c.525_551dupGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Ser184_Gly185insGlyGlySerSerThrProGlyGlySer	disruptive_inframe_insertion	Exon 2 of 2	ENSP00000444198.2	A0A0A0MTM3
	CITED2	ENST00000536159.2	TSL:3	c.510_536dupGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Ser179_Gly180insGlyGlySerSerThrProGlyGlySer	disruptive_inframe_insertion	Exon 2 of 2	ENSP00000442831.1	Q99967-1

Frequencies

GnomAD3 genomes AF: 0.0000399 AC: 6 AN: 150206 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000982

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000210 AC: 4 AN: 190406 AF XY: 0.0000189

Gnomad AFR exome AF: 0.0000980

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000113

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000264 AC: 37 AN: 1403390 Hom.: 0 Cov.: 30 AF XY: 0.0000301 AC XY: 21 AN XY: 697196

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000668 AC: 2 AN: 29942

American (AMR) AF: 0.00 AC: 0 AN: 36534

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22886

East Asian (EAS) AF: 0.00 AC: 0 AN: 36372

South Asian (SAS) AF: 0.0000129 AC: 1 AN: 77330

European-Finnish (FIN) AF: 0.0000203 AC: 1 AN: 49186

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5544

European-Non Finnish (NFE) AF: 0.0000230 AC: 25 AN: 1087902

Other (OTH) AF: 0.000139 AC: 8 AN: 57694

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000550038), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000333 AC: 5 AN: 150318 Hom.: 0 Cov.: 32 AF XY: 0.0000272 AC XY: 2 AN XY: 73440

African (AFR) AF: 0.0000979 AC: 4 AN: 40872

American (AMR) AF: 0.00 AC: 0 AN: 15126

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3458

East Asian (EAS) AF: 0.00 AC: 0 AN: 5044

South Asian (SAS) AF: 0.00 AC: 0 AN: 4716

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10366

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 278

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67470

Other (OTH) AF: 0.00 AC: 0 AN: 2084

Asia WGS AF: 0.000577 AC: 2 AN: 3478

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	CITED2-related disorder (1)
-	1	-	Ventricular septal defect 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=77/23	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs779637348; hg19: chr6-139694545;