NM_006218.4:c.32_52delGGGGCATCCACTTGATGCCCC

Variant names:

• chr3-179198856-TGGGGCATCCACTTGATGCCCC-T
• NM_006218.4:c.32_52delGGGGCATCCACTTGATGCCCC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM2 PM4 PP3 PP5_Moderate

The NM_006218.4(PIK3CA):​c.32_52delGGGGCATCCACTTGATGCCCC​(p.Trp11_Pro18delinsSer) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PIK3CA NM_006218.4 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.51

Genes affected

PIK3CA (HGNC:8975): (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha) Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_006218.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 3-179198856-TGGGGCATCCACTTGATGCCCC-T is Pathogenic according to our data. Variant chr3-179198856-TGGGGCATCCACTTGATGCCCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1691323.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PIK3CA	NM_006218.4	c.32_52delGGGGCATCCACTTGATGCCCC	p.Trp11_Pro18delinsSer	disruptive_inframe_deletion	Exon 2 of 21	ENST00000263967.4	NP_006209.2
PIK3CA	XM_006713658.5	c.32_52delGGGGCATCCACTTGATGCCCC	p.Trp11_Pro18delinsSer	disruptive_inframe_deletion	Exon 2 of 21		XP_006713721.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PIK3CA	ENST00000263967.4	c.32_52delGGGGCATCCACTTGATGCCCC	p.Trp11_Pro18delinsSer	disruptive_inframe_deletion	Exon 2 of 21	2	NM_006218.4	ENSP00000263967.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Aug 20, 2021

Seattle Children's Hospital Molecular Genetics Laboratory, Seattle Children's Hospital

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is not reported in the medical literature, control population database (gnomAD v2.1.1) nor in ClinVar or cancer databases (cBioPortal, COSMIC, and NCI's Genomic Data Commons). This variant is a deletion of 21 base pairs predicted to result in the loss of eight amino acids and the insertion of a serine, denoted p.Trp11_Pro18delinsSer. This variant is located within the highly conserved PI3K adaptor-binding domain (ABD) region (UniProt P42336). Although this variant has not been previously reported, deletions in this region have been reported as oncogenic (PMID: 21266528, COSMIC and cBioPortal). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-178916644;