chr3-179198856-TGGGGCATCCACTTGATGCCCC-T
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM4PP3PP5_Moderate
The NM_006218.4(PIK3CA):c.32_52delGGGGCATCCACTTGATGCCCC(p.Trp11_Pro18delinsSer) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). The gene PIK3CA is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_006218.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genesInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- megalencephaly-capillary malformation-polymicrogyria syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
- vascular malformationInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- Cowden diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cowden syndrome 5Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- familial ovarian cancerInheritance: Unknown Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006218.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PIK3CA | TSL:2 MANE Select | c.32_52delGGGGCATCCACTTGATGCCCC | p.Trp11_Pro18delinsSer | disruptive_inframe_deletion | Exon 2 of 21 | ENSP00000263967.3 | P42336 | ||
| PIK3CA | c.32_52delGGGGCATCCACTTGATGCCCC | p.Trp11_Pro18delinsSer | disruptive_inframe_deletion | Exon 2 of 21 | ENSP00000625249.1 | ||||
| PIK3CA | c.32_52delGGGGCATCCACTTGATGCCCC | p.Trp11_Pro18delinsSer | disruptive_inframe_deletion | Exon 3 of 22 | ENSP00000546604.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at