NM_006701.5:c.88_110delTTCGGCCACGACTGGGATCCTAC

Variant names:

• chr18-79988282-CGTAGGATCCCAGTCGTGGCCGAA-C
• rs1555719172
• NM_006701.5:c.88_110delTTCGGCCACGACTGGGATCCTAC

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_Strong PM2 PP5_Very_Strong

The NM_006701.5(TXNL4A):​c.88_110delTTCGGCCACGACTGGGATCCTAC​(p.Phe30ValfsTer16) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000689 in 1,451,470 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: TXNL4A NM_006701.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 8.70

Genes affected

TXNL4A (HGNC:30551): (thioredoxin like 4A) The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein interactions have been observed with the polyglutamine tract-binding protein 1 (PQBP1). Mutations in both the coding region and promoter region of this gene have been associated with Burn-McKeown syndrome, which is a rare disorder characterized by craniofacial dysmorphisms, cardiac defects, hearing loss, and bilateral choanal atresia. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.795 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 18-79988282-CGTAGGATCCCAGTCGTGGCCGAA-C is Pathogenic according to our data. Variant chr18-79988282-CGTAGGATCCCAGTCGTGGCCGAA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 451615.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TXNL4A	NM_006701.5	c.88_110delTTCGGCCACGACTGGGATCCTAC	p.Phe30ValfsTer16	frameshift_variant	Exon 1 of 3	ENST00000269601.10	NP_006692.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TXNL4A	ENST00000269601.10	c.88_110delTTCGGCCACGACTGGGATCCTAC	p.Phe30ValfsTer16	frameshift_variant	Exon 1 of 3	1	NM_006701.5	ENSP00000269601.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 6.89e-7 AC: 1 AN: 1451470 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 722018

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.05e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome Pathogenic:2

Jan 08, 2024

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Phe30ValfsX16 variant in TXNL4A has not been previously reported in individuals with TXNL4A-related craniofacial disorders, including Burn-McKeown syndrome (BMKS), but has been reported by other clinical laboratories in ClinVar (Variation ID 451615). It was absent from large population studies (gnomAD v.3.1.2). This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 30 and leads to a premature termination codon 16 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Biallelic loss of function of the TXNL4A gene is strongly associated with TXNL4A-related craniofacial disorders, including BMKS (Wieczorek 2014 PMID: 25434003, Wood 2020 PMID: 32735620). The majority of individuals reported with this condition have been found to have a loss of function variant on one allele and a 34-bp promoter deletion on the other (Wieczorek 2014 PMID: 25434003). In summary, although additional studies are required to fully establish its clinical significance, this variant meets criteria to be classified as likely pathogenic for autosomal recessive TXNL4A-related craniofacial disorders. ACMG/AMP Criteria applied: PVS1, PM2_Supporting. -

Apr 08, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Aug 22, 2017

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.88_110del23 variant in the TXNL4A gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The c.88_110del23 variant causes a frameshift starting with codon Phenylalanine 30, changes this amino acid to a Valine residue, and creates a premature Stop codon at position 16 of the new reading frame, denoted p.Phe30ValfsX16. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. The c.88_110del23 variant is not observed in large population cohorts (Lek et al., 2016; 1000 Genomes Consortium et al., 2015; Exome Variant Server). We interpret c.88_110del23 as a likely pathogenic variant. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555719172; hg19: chr18-77748282;