NM_006946.4:c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA

Variant names:

• chr11-66707534-GTCCATGAGGTAGAGCAGGTCCTGGAACACCTTCTGCAGC-G
• rs1554985851
• NM_006946.4:c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PM4 PP3 PP5_Very_Strong

The NM_006946.4(SPTBN2):​c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA​(p.Glu532_Met544del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SPTBN2 NM_006946.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 7.91
• Publications: 1 publications found

Genes affected

SPTBN2 (HGNC:11276): (spectrin beta, non-erythrocytic 2) Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]

SPTBN2 Gene-Disease associations (from GenCC):

• autosomal recessive spinocerebellar ataxia 14

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• spinocerebellar ataxia type 5

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Illumina, G2P

ACMG classification

Our verdict: Pathogenic. The variant received 11 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006946.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-66707534-GTCCATGAGGTAGAGCAGGTCCTGGAACACCTTCTGCAGC-G is Pathogenic according to our data. Variant chr11-66707534-GTCCATGAGGTAGAGCAGGTCCTGGAACACCTTCTGCAGC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 448482.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006946.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPTBN2	NM_006946.4	MANE Select	c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu532_Met544del	disruptive_inframe_deletion	Exon 13 of 38	NP_008877.2
	SPTBN2	NM_001411025.1		c.1617_1655delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu539_Met551del	disruptive_inframe_deletion	Exon 11 of 36	NP_001397954.1
	SPTBN2	NM_001437541.1		c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu532_Met544del	disruptive_inframe_deletion	Exon 12 of 37	NP_001424470.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPTBN2	ENST00000533211.6	TSL:5 MANE Select	c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu532_Met544del	disruptive_inframe_deletion	Exon 13 of 38	ENSP00000432568.1
	SPTBN2	ENST00000309996.7	TSL:1	c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu532_Met544del	disruptive_inframe_deletion	Exon 12 of 37	ENSP00000311489.2
	SPTBN2	ENST00000617502.5	TSL:5	c.1617_1655delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu539_Met551del	disruptive_inframe_deletion	Exon 11 of 36	ENSP00000482000.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
4	-	-	not provided (4)
2	-	-	Spinocerebellar ataxia type 5 (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554985851; hg19: chr11-66475005;