rs1554985851

Variant names:

• chr11-66707534-GTCCATGAGGTAGAGCAGGTCCTGGAACACCTTCTGCAGC-G
• rs1554985851
• NM_006946.4:c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PM4 PP3 PP5_Very_Strong

The NM_006946.4(SPTBN2):​c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA​(p.Glu532_Met544del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SPTBN2 NM_006946.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 7.91
• Publications: 1 publications found

Genes affected

SPTBN2 (HGNC:11276): (spectrin beta, non-erythrocytic 2) Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]

SPTBN2 Gene-Disease associations (from GenCC):

• autosomal recessive spinocerebellar ataxia 14

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• spinocerebellar ataxia type 5

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Illumina, G2P

ACMG classification

Our verdict: Pathogenic. The variant received 11 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006946.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-66707534-GTCCATGAGGTAGAGCAGGTCCTGGAACACCTTCTGCAGC-G is Pathogenic according to our data. Variant chr11-66707534-GTCCATGAGGTAGAGCAGGTCCTGGAACACCTTCTGCAGC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 448482.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SPTBN2	NM_006946.4	c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu532_Met544del	disruptive_inframe_deletion	Exon 13 of 38	ENST00000533211.6	NP_008877.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SPTBN2	ENST00000533211.6	c.1596_1634delGCTGCAGAAGGTGTTCCAGGACCTGCTCTACCTCATGGA	p.Glu532_Met544del	disruptive_inframe_deletion	Exon 13 of 38	5	NM_006946.4	ENSP00000432568.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:4

Feb 20, 2018

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Nov 16, 2022

Athena Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been reported in large, multi-ethnic general populations (http://gnomad.broadinstitute.org). In multiple families, this variant segregates with spinocerebellar ataxia in an autosomal dominant manner. Assessment of experimental evidence suggests this variant results in abnormal protein function. Studies show that this variant interferes with beta-III spectrin stabilization of glutamate transporters and receptors (PMID: 16429157, 20368622, 25057192). -

Dec 04, 2023

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Published functional studies demonstrate a damaging effect as this in-frame deletion causes deficits in synapse formation at the neuromuscular junction, disrupts vesicular trafficking, and impacts function and stabilization of key proteins in Purkinje cells (PMID: 25057192, 16429157, 20368622); In-frame deletion of 13 amino acids in a non-repeat region; Not observed at significant frequency in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 33801522, 25057192, 20368622, 16429157) -

Jun 23, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1596_1634del, results in the deletion of 13 amino acid(s) of the SPTBN2 protein (p.Glu532_Met544del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with autosomal dominant spinal cerebellar ataxia type 5 (PMID: 16429157). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 448482). Algorithms developed to predict the effect of variants on gene product structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects SPTBN2 function (PMID: 25057192). For these reasons, this variant has been classified as Pathogenic. -

Spinocerebellar ataxia type 5 Pathogenic:2

Feb 01, 2006

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Nov 25, 2022

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: SPTBN2 c.1596_1634del39 (p.Glu532_Met544del) results in an in-frame deletion that is predicted to remove 13 amino acids from the encoded protein. The variant was absent in 236106 control chromosomes. c.1596_1634del39 has been reported in the literature in multiple individuals affected with Spinocerebellar Ataxia 5 from a large 11-generation American kindred (example, Ikeda_2006). These data indicate that the variant is very likely to be associated with disease. At two publications report experimental evidence evaluating an impact on protein function demonstrating, 1. disruption of the normal stabilization of the glutamate transporter EAAT4 at the plasma membrane and 2. a mouse model with features consistent to pathophysiology of human disease (example, Ikeda_2006, Armbrust_2014). Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554985851; hg19: chr11-66475005;