NM_007194.4:c.451_472delGGTCCTAAAAACTCTTACATTG
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_007194.4(CHEK2):c.451_472delGGTCCTAAAAACTCTTACATTG(p.Gly151HisfsTer3) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_007194.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Pathogenic:2
This variant deletes 22 nucleotides in exon 4 of the CHEK2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CHEK2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -
The c.451_472del22 pathogenic mutation, located in coding exon 3 of the CHEK2 gene, results from a deletion of 22 nucleotides at nucleotide positions 451 to 472, causing a translational frameshift with a predicted alternate stop codon (p.G151Hfs*3). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
Familial cancer of breast Pathogenic:1
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at