NM_007194.4:c.451_472delGGTCCTAAAAACTCTTACATTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_007194.4(CHEK2):​c.451_472delGGTCCTAAAAACTCTTACATTG​(p.Gly151HisfsTer3) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G151G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CHEK2
NM_007194.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 6.65

Publications

0 publications found
Variant links:
Genes affected
CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
CHEK2 Gene-Disease associations (from GenCC):
  • CHEK2-related cancer predisposition
    Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
  • hereditary breast carcinoma
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
  • Li-Fraumeni syndrome 2
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
  • acute myeloid leukemia
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary nonpolyposis colon cancer
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen
  • familial ovarian cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 22-28725096-GCAATGTAAGAGTTTTTAGGACC-G is Pathogenic according to our data. Variant chr22-28725096-GCAATGTAAGAGTTTTTAGGACC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 491615.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CHEK2NM_007194.4 linkc.451_472delGGTCCTAAAAACTCTTACATTG p.Gly151HisfsTer3 frameshift_variant Exon 4 of 15 ENST00000404276.6 NP_009125.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CHEK2ENST00000404276.6 linkc.451_472delGGTCCTAAAAACTCTTACATTG p.Gly151HisfsTer3 frameshift_variant Exon 4 of 15 1 NM_007194.4 ENSP00000385747.1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:2
Dec 23, 2024
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.451_472del22 pathogenic mutation, located in coding exon 3 of the CHEK2 gene, results from a deletion of 22 nucleotides at nucleotide positions 451 to 472, causing a translational frameshift with a predicted alternate stop codon (p.G151Hfs*3). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Sep 02, 2020
Color Diagnostics, LLC DBA Color Health
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant deletes 22 nucleotides in exon 4 of the CHEK2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CHEK2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Familial cancer of breast Pathogenic:1
Jun 23, 2023
Myriad Genetics, Inc.
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
6.7
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555926975; hg19: chr22-29121084; API