NM_015488.5:c.-7_15dupTCTGAACATGGCGGCGGTGGTA

Variant names:

• chr2-218270527-G-GATCTGAACATGGCGGCGGTGGT
• rs1690786140
• NM_015488.5:c.-7_15dupTCTGAACATGGCGGCGGTGGTA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_015488.5(PNKD):​c.-7_15dupTCTGAACATGGCGGCGGTGGTA​(p.Ala6fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,234 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
• Consequence: PNKD NM_015488.5 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.40

Genes affected

PNKD (HGNC:9153): (PNKD metallo-beta-lactamase domain containing) This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PNKD	NM_015488.5	c.-7_15dupTCTGAACATGGCGGCGGTGGTA	p.Ala6fs	frameshift_variant	Exon 1 of 10	ENST00000273077.9	NP_056303.3
PNKD	NM_001077399.3	c.-7_15dupTCTGAACATGGCGGCGGTGGTA	p.Ala6fs	frameshift_variant	Exon 1 of 3		NP_001070867.1
PNKD	XM_017003771.2	c.-7_15dupTCTGAACATGGCGGCGGTGGTA	p.Ala6fs	frameshift_variant	Exon 1 of 9		XP_016859260.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PNKD	ENST00000273077.9	c.-7_15dupTCTGAACATGGCGGCGGTGGTA	p.Ala6fs	frameshift_variant	Exon 1 of 10	1	NM_015488.5	ENSP00000273077.4

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152234 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 16

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152234 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74376

Gnomad4 AFR AF: 0.0000241

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Aug 14, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed at significant frequency in large population cohorts (gnomAD); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene or region of a gene for which loss of function is not a well-established mechanism of disease; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1690786140; hg19: chr2-219135250;