NM_016335.6:c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_016335.6(PRODH):c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC(p.Thr44_Ala52del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_016335.6 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hyperprolinemia type 1Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Laboratory for Molecular Medicine, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_016335.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PRODH | MANE Select | c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC | p.Thr44_Ala52del | conservative_inframe_deletion | Exon 1 of 14 | NP_057419.5 | |||
| PRODH | c.-52+232_-52+258delACGGCAGTGCGGCCGCCGGTGCCCGCC | intron | N/A | NP_001182155.2 | O43272-2 | ||||
| PRODH | c.-52+12_-52+38delACGGCAGTGCGGCCGCCGGTGCCCGCC | intron | N/A | NP_001355179.2 | E7EQL6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PRODH | TSL:1 MANE Select | c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC | p.Thr44_Ala52del | conservative_inframe_deletion | Exon 1 of 14 | ENSP00000349577.6 | O43272-4 | ||
| PRODH | TSL:1 | c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC | p.Thr44_Ala52del | conservative_inframe_deletion | Exon 2 of 15 | ENSP00000480347.1 | O43272-4 | ||
| PRODH | TSL:1 | c.-52+232_-52+258delACGGCAGTGCGGCCGCCGGTGCCCGCC | intron | N/A | ENSP00000334726.2 | O43272-2 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD2 exomes AF: 0.0000717 AC: 5AN: 69696 AF XY: 0.0000493 show subpopulations
GnomAD4 genome Cov.: 0
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at