rs949036081

Variant names:

• chr22-18936131-CGGCGGGCACCGGCGGCCGCACTGCCGT-C
• rs949036081
• NM_016335.6:c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_016335.6(PRODH):​c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC​(p.Thr44_Ala52del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 0)
• Consequence: PRODH NM_016335.6 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 1.99
• Publications: 0 publications found

Genes affected

PRODH (HGNC:9453): (proline dehydrogenase 1) This gene encodes a mitochondrial protein that catalyzes the first step in proline degradation. Mutations in this gene are associated with hyperprolinemia type 1 and susceptibility to schizophrenia 4 (SCZD4). This gene is located on chromosome 22q11.21, a region which has also been associated with the contiguous gene deletion syndromes, DiGeorge and CATCH22. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]

PRODH Gene-Disease associations (from GenCC):

• hyperprolinemia type 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Laboratory for Molecular Medicine, Orphanet, Labcorp Genetics (formerly Invitae)

ENSG00000283809 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_016335.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PRODH	NM_016335.6	c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC	p.Thr44_Ala52del	conservative_inframe_deletion	Exon 1 of 14	ENST00000357068.11	NP_057419.5
PRODH	NM_001195226.2	c.-52+232_-52+258delACGGCAGTGCGGCCGCCGGTGCCCGCC		intron_variant	Intron 1 of 13		NP_001182155.2
PRODH	NM_001368250.2	c.-52+12_-52+38delACGGCAGTGCGGCCGCCGGTGCCCGCC		intron_variant	Intron 1 of 13		NP_001355179.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PRODH	ENST00000357068.11	c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC	p.Thr44_Ala52del	conservative_inframe_deletion	Exon 1 of 14	1	NM_016335.6	ENSP00000349577.6
ENSG00000283809	ENST00000638240.1	c.514-3538_514-3512delGGGCACCGGCGGCCGCACTGCCGTGGC		intron_variant	Intron 4 of 5	5		ENSP00000492446.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD2 exomes AF: 0.0000717 AC: 5 AN: 69696 AF XY: 0.0000493

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000193

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

Alfa AF: 0.000224 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Proline dehydrogenase deficiency Uncertain:1

Dec 28, 2016

Mayo Clinic Laboratories, Mayo Clinic

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Proline dehydrogenase deficiency;C1833247:Schizophrenia 4 Uncertain:1

Jun 19, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs949036081; hg19: chr22-18923644;