NM_016648.4:c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT

Variant names:

• chr4-112646334-TTTTTCATTTTCTTTAGATGTTGATATATCACTACTTGTGTC-T
• rs1578580129
• NM_016648.4:c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_016648.4(LARP7):​c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT​(p.Tyr68fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LARP7 NM_016648.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.25
• Publications: 0 publications found

Genes affected

LARP7 (HGNC:24912): (La ribonucleoprotein 7, transcriptional regulator) This gene encodes a protein which is found in the 7SK snRNP (small nuclear ribonucleoprotein). This snRNP complex inhibits a cyclin-dependent kinase, positive transcription elongation factor b, which is required for paused RNA polymerase II at a promoter to begin transcription elongation. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]

MIR302CHG (HGNC:41070): (miR-302/367 cluster host gene)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 4-112646334-TTTTTCATTTTCTTTAGATGTTGATATATCACTACTTGTGTC-T is Pathogenic according to our data. Variant chr4-112646334-TTTTTCATTTTCTTTAGATGTTGATATATCACTACTTGTGTC-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 666361.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_016648.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LARP7	NM_016648.4	MANE Select	c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT	p.Tyr68fs	frameshift splice_acceptor splice_region intron	Exon 3 of 13	NP_057732.2	Q4G0J3-1
	LARP7	NM_001370981.1		c.-35-12_-7delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT		splice_region	Exon 3 of 13	NP_001357910.1	A0A8I5KUI4
	LARP7	NM_001370982.1		c.-35-12_-7delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT		splice_region	Exon 3 of 13	NP_001357911.1	A0A8I5KUI4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LARP7	ENST00000344442.10	TSL:2 MANE Select	c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT	p.Tyr68fs	frameshift splice_acceptor splice_region intron	Exon 3 of 13	ENSP00000344950.5	Q4G0J3-1
	LARP7	ENST00000509061.5	TSL:1	c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT	p.Tyr68fs	frameshift splice_acceptor splice_region intron	Exon 5 of 15	ENSP00000422626.2	Q4G0J3-1
	LARP7	ENST00000509622.5	TSL:1	n.100-12_128delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT		splice_acceptor splice_region intron non_coding_transcript_exon	Exon 3 of 13	ENSP00000422451.1	D6RBH8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Microcephalic primordial dwarfism, Alazami type (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1578580129; hg19: chr4-113567490;