chr4-112646334-TTTTTCATTTTCTTTAGATGTTGATATATCACTACTTGTGTC-T

Variant names:

• chr4-112646334-TTTTTCATTTTCTTTAGATGTTGATATATCACTACTTGTGTC-T
• rs1578580129
• NM_016648.4:c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_016648.4(LARP7):​c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT​(p.Tyr68fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LARP7 NM_016648.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.25

Genes affected

LARP7 (HGNC:24912): (La ribonucleoprotein 7, transcriptional regulator) This gene encodes a protein which is found in the 7SK snRNP (small nuclear ribonucleoprotein). This snRNP complex inhibits a cyclin-dependent kinase, positive transcription elongation factor b, which is required for paused RNA polymerase II at a promoter to begin transcription elongation. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]

MIR302CHG (HGNC:41070): (miR-302/367 cluster host gene)

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-112646334-TTTTTCATTTTCTTTAGATGTTGATATATCACTACTTGTGTC-T is Pathogenic according to our data. Variant chr4-112646334-TTTTTCATTTTCTTTAGATGTTGATATATCACTACTTGTGTC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 666361.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LARP7	NM_016648.4	c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT	p.Tyr68fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 3 of 13	ENST00000344442.10	NP_057732.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LARP7	ENST00000344442.10	c.203-12_231delCATTTTCTTTAGATGTTGATATATCACTACTTGTGTCTTTT	p.Tyr68fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 3 of 13	2	NM_016648.4	ENSP00000344950.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Microcephalic primordial dwarfism, Alazami type Pathogenic:1

Jan 04, 2016

Equipe Genetique des Anomalies du Developpement, Université de Bourgogne

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1578580129; hg19: chr4-113567490;