NM_017633.3:c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG

Variant names:

• chr6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A
• rs754008809
• NM_017633.3:c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 2P and 6B. PM4 BP6_Moderate BS2

The NM_017633.3(TENT5A):​c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG​(p.Gly35_Gly44del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.0069 (4 hom., cov: 0)
  • Exomes 𝑓: 0.0081 (69 hom.)
  • Failed GnomAD Quality Control
• Consequence: TENT5A NM_017633.3 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 5.41
• Publications: 6 publications found

Genes affected

TENT5A (HGNC:18345): (terminal nucleotidyltransferase 5A) Enables RNA binding activity. Predicted to be involved in mRNA stabilization. Predicted to act upstream of or within response to bacterium. Implicated in lung non-small cell carcinoma; osteoarthritis; and osteogenesis imperfecta type 18. [provided by Alliance of Genome Resources, Apr 2022]

TENT5A Gene-Disease associations (from GenCC):

• osteogenesis imperfecta, type 18

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• osteogenesis imperfecta

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017633.3.
• BP6: Variant 6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A is Benign according to our data. Variant chr6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A is described in ClinVar as Benign. ClinVar VariationId is 1165050.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 4 AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017633.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	NM_017633.3	MANE Select	c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly35_Gly44del	disruptive_inframe_deletion	Exon 2 of 3	NP_060103.2	Q96IP4-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	ENST00000320172.11	TSL:1 MANE Select	c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly35_Gly44del	disruptive_inframe_deletion	Exon 2 of 3	ENSP00000318298.6	Q96IP4-1
	TENT5A	ENST00000369756.3	TSL:1	c.345_374delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly116_Gly125del	disruptive_inframe_deletion	Exon 2 of 3	ENSP00000358771.3	Q5TF85
	TENT5A	ENST00000369754.7	TSL:1	c.159_188delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly54_Gly63del	disruptive_inframe_deletion	Exon 2 of 3	ENSP00000358769.3	Q96IP4-2

Frequencies

GnomAD3 genomes AF: 0.00693 AC: 968 AN: 139632 Hom.: 4 Cov.: 0

Gnomad AFR AF: 0.00424

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00533

Gnomad ASJ AF: 0.0174

Gnomad EAS AF: 0.000877

Gnomad SAS AF: 0.00455

Gnomad FIN AF: 0.0149

Gnomad MID AF: 0.0104

Gnomad NFE AF: 0.00771

Gnomad OTH AF: 0.00832

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00810 AC: 9730 AN: 1201596 Hom.: 69 AF XY: 0.00810 AC XY: 4886 AN XY: 603396

African (AFR) AF: 0.00385 AC: 98 AN: 25444

American (AMR) AF: 0.00414 AC: 154 AN: 37202

Ashkenazi Jewish (ASJ) AF: 0.0159 AC: 364 AN: 22934

East Asian (EAS) AF: 0.000396 AC: 15 AN: 37832

South Asian (SAS) AF: 0.00379 AC: 282 AN: 74460

European-Finnish (FIN) AF: 0.0182 AC: 784 AN: 42970

Middle Eastern (MID) AF: 0.00683 AC: 28 AN: 4100

European-Non Finnish (NFE) AF: 0.00838 AC: 7582 AN: 905290

Other (OTH) AF: 0.00824 AC: 423 AN: 51364

GnomAD4 genome AF: 0.00693 AC: 968 AN: 139710 Hom.: 4 Cov.: 0 AF XY: 0.00753 AC XY: 510 AN XY: 67720

African (AFR) AF: 0.00423 AC: 155 AN: 36608

American (AMR) AF: 0.00533 AC: 76 AN: 14270

Ashkenazi Jewish (ASJ) AF: 0.0174 AC: 58 AN: 3342

East Asian (EAS) AF: 0.000880 AC: 4 AN: 4546

South Asian (SAS) AF: 0.00455 AC: 19 AN: 4178

European-Finnish (FIN) AF: 0.0149 AC: 142 AN: 9518

Middle Eastern (MID) AF: 0.0112 AC: 3 AN: 268

European-Non Finnish (NFE) AF: 0.00771 AC: 495 AN: 64164

Other (OTH) AF: 0.00826 AC: 16 AN: 1938

Alfa AF: 0.00793 Hom.: 1118

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4
Mutation Taster		=182/18	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs754008809; hg19: chr6-82461727; COSMIC: COSV60787211; COSMIC: COSV60787211;