chr6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A

Position:

• chr6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 2P and 6B. PM4 BP6_Moderate BS2

The NM_017633.3(TENT5A):​c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG​(p.Gly35_Gly44del) variant causes a disruptive inframe deletion change. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.0069 (4 hom., cov: 0)
  • Exomes 𝑓: 0.0081 (69 hom.)
  • Failed GnomAD Quality Control
• Consequence: TENT5A NM_017633.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 5.41

Genes affected

TENT5A (HGNC:18345): (terminal nucleotidyltransferase 5A) Enables RNA binding activity. Predicted to be involved in mRNA stabilization. Predicted to act upstream of or within response to bacterium. Implicated in lung non-small cell carcinoma; osteoarthritis; and osteogenesis imperfecta type 18. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017633.3.
• BP6: Variant 6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A is Benign according to our data. Variant chr6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A is described in ClinVar as [Benign]. Clinvar id is 1165050.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 4 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TENT5A	NM_017633.3	c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly35_Gly44del	disruptive_inframe_deletion	2/3	ENST00000320172.11	NP_060103.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TENT5A	ENST00000320172.11	c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly35_Gly44del	disruptive_inframe_deletion	2/3	1	NM_017633.3	ENSP00000318298.6
TENT5A	ENST00000369756.3	c.345_374delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly116_Gly125del	disruptive_inframe_deletion	2/3	1		ENSP00000358771.3
TENT5A	ENST00000369754.7	c.159_188delCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly54_Gly63del	disruptive_inframe_deletion	2/3	1		ENSP00000358769.3

Frequencies

GnomAD3 genomes AF: 0.00693 AC: 968 AN: 139632 Hom.: 4 Cov.: 0

Gnomad AFR AF: 0.00424

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00533

Gnomad ASJ AF: 0.0174

Gnomad EAS AF: 0.000877

Gnomad SAS AF: 0.00455

Gnomad FIN AF: 0.0149

Gnomad MID AF: 0.0104

Gnomad NFE AF: 0.00771

Gnomad OTH AF: 0.00832

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00810 AC: 9730 AN: 1201596 Hom.: 69 AF XY: 0.00810 AC XY: 4886 AN XY: 603396

Gnomad4 AFR exome AF: 0.00385

Gnomad4 AMR exome AF: 0.00414

Gnomad4 ASJ exome AF: 0.0159

Gnomad4 EAS exome AF: 0.000396

Gnomad4 SAS exome AF: 0.00379

Gnomad4 FIN exome AF: 0.0182

Gnomad4 NFE exome AF: 0.00838

Gnomad4 OTH exome AF: 0.00824

GnomAD4 genome AF: 0.00693 AC: 968 AN: 139710 Hom.: 4 Cov.: 0 AF XY: 0.00753 AC XY: 510 AN XY: 67720

Gnomad4 AFR AF: 0.00423

Gnomad4 AMR AF: 0.00533

Gnomad4 ASJ AF: 0.0174

Gnomad4 EAS AF: 0.000880

Gnomad4 SAS AF: 0.00455

Gnomad4 FIN AF: 0.0149

Gnomad4 NFE AF: 0.00771

Gnomad4 OTH AF: 0.00826

Alfa AF: 0.00793 Hom.: 1118

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 30, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs754008809; hg19: chr6-82461727;