NM_017890.5:c.10240_10282delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG

Variant names:

• chr8-99853553-ACTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG-A
• rs875989882
• NM_017890.5:c.10240_10282delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_017890.5(VPS13B):​c.10240_10282delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG​(p.Leu3414ValfsTer27) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: VPS13B NM_017890.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.65
• Publications: 0 publications found

Genes affected

VPS13B (HGNC:2183): (vacuolar protein sorting 13 homolog B) This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

VPS13B Gene-Disease associations (from GenCC):

• Cohen syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Myriad Women’s Health, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Laboratory for Molecular Medicine, ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-99853553-ACTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG-A is Pathogenic according to our data. Variant chr8-99853553-ACTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG-A is described in ClinVar as Pathogenic. ClinVar VariationId is 226118.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VPS13B	NM_017890.5	c.10240_10282delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3414ValfsTer27	frameshift_variant	Exon 56 of 62	ENST00000358544.7	NP_060360.3
VPS13B	NM_152564.5	c.10165_10207delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3389ValfsTer27	frameshift_variant	Exon 56 of 62	ENST00000357162.7	NP_689777.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VPS13B	ENST00000358544.7	c.10240_10282delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3414ValfsTer27	frameshift_variant	Exon 56 of 62	1	NM_017890.5	ENSP00000351346.2
VPS13B	ENST00000357162.7	c.10165_10207delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3389ValfsTer27	frameshift_variant	Exon 56 of 62	1	NM_152564.5	ENSP00000349685.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Cohen syndrome Pathogenic:1

Mar 01, 2016

Center of Genomic medicine, Geneva, University Hospital of Geneva

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This inherited recessive pathogenic mutation in the VPS13B gene in combination with a second recessive pathogenic mutation in the same gene, NM_152564.4:c.10081dup, was identified in a patient with the Cohen syndrome. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.6
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs875989882; hg19: chr8-100865781;