rs875989882

Positions:

• chr8-99853553-ACTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG-A

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_152564.5(VPS13B):​c.10165_10207delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG​(p.Leu3389fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: VPS13B NM_152564.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.65

Genes affected

VPS13B (HGNC:2183): (vacuolar protein sorting 13 homolog B) This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

VPS13B (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 8-99853553-ACTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG-A is Pathogenic according to our data. Variant chr8-99853553-ACTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG-A is described in ClinVar as [Pathogenic]. Clinvar id is 226118.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
VPS13B	NM_017890.5	c.10240_10282delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3414fs	frameshift_variant	56/62	ENST00000358544.7	NP_060360.3
VPS13B	NM_152564.5	c.10165_10207delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3389fs	frameshift_variant	56/62	ENST00000357162.7	NP_689777.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
VPS13B	ENST00000358544.7	c.10240_10282delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3414fs	frameshift_variant	56/62	1	NM_017890.5	ENSP00000351346.2
VPS13B	ENST00000357162.7	c.10165_10207delCTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG	p.Leu3389fs	frameshift_variant	56/62	1	NM_152564.5	ENSP00000349685.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Cohen syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Center of Genomic medicine, Geneva, University Hospital of Geneva

Mar 01, 2016

This inherited recessive pathogenic mutation in the VPS13B gene in combination with a second recessive pathogenic mutation in the same gene, NM_152564.4:c.10081dup, was identified in a patient with the Cohen syndrome. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs875989882; hg19: chr8-100865781;