NM_018713.3:c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_018713.3(SLC30A10):c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC(p.Ala166GlnfsTer7) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_018713.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- cirrhosis - dystonia - polycythemia - hypermanganesemia syndromeInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_018713.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SLC30A10 | NM_018713.3 | MANE Select | c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC | p.Ala166GlnfsTer7 | frameshift | Exon 1 of 4 | NP_061183.2 | ||
| SLC30A10 | NM_001416005.1 | c.-218_-161delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC | 5_prime_UTR | Exon 1 of 4 | NP_001402934.1 | ||||
| SLC30A10 | NM_001376929.1 | c.452-840_452-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC | intron | N/A | NP_001363858.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SLC30A10 | ENST00000366926.4 | TSL:1 MANE Select | c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC | p.Ala166GlnfsTer7 | frameshift | Exon 1 of 4 | ENSP00000355893.4 | ||
| SLC30A10 | ENST00000356609.2 | TSL:1 | n.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC | non_coding_transcript_exon | Exon 1 of 4 | ENSP00000349018.2 | |||
| SLC30A10 | ENST00000696608.1 | c.452-840_452-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC | intron | N/A | ENSP00000512752.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hypermanganesemia with dystonia, polycythemia, and cirrhosis Other:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at