rs1553313783

Variant names:

• chr1-219927887-GGGGCTGTCGGGTCCGCCGCGCGCCGCGGGTCCTCCGCGCCCTGAGGCCCCCCGAAAGC-G
• rs1553313783
• NM_018713.3:c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_018713.3(SLC30A10):​c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC​(p.Ala166GlnfsTer7) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SLC30A10 NM_018713.3 frameshift
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.439
• Publications: 1 publications found

Genes affected

SLC30A10 (HGNC:25355): (solute carrier family 30 member 10) This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]

SLC30A10 Gene-Disease associations (from GenCC):

• cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC30A10	NM_018713.3	c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC	p.Ala166GlnfsTer7	frameshift_variant	Exon 1 of 4	ENST00000366926.4	NP_061183.2
SLC30A10	NM_001416005.1	c.-218_-161delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC		5_prime_UTR_variant	Exon 1 of 4		NP_001402934.1
SLC30A10	NM_001376929.1	c.452-840_452-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC		intron_variant	Intron 1 of 3		NP_001363858.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC30A10	ENST00000366926.4	c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC	p.Ala166GlnfsTer7	frameshift_variant	Exon 1 of 4	1	NM_018713.3	ENSP00000355893.4
SLC30A10	ENST00000356609.2	n.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC		non_coding_transcript_exon_variant	Exon 1 of 4	1		ENSP00000349018.2
SLC30A10	ENST00000696608.1	c.452-840_452-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC		intron_variant	Intron 1 of 3			ENSP00000512752.1
SLC30A10	ENST00000484239.5	n.81-840_81-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC		intron_variant	Intron 1 of 8	2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Hypermanganesemia with dystonia, polycythemia, and cirrhosis Other:1

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.44
Mutation Taster		=13/187	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553313783; hg19: chr1-220101229;