NM_018941.4:c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC

Variant names:

• chr8-1763878-C-CAGCCCAGGTGAGCGCTCAGGG
• rs1064793088
• NM_018941.4:c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_018941.4(CLN8):​c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000139 in 151,346 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: 𝑓 0.00014 (0 hom., cov: 28)
• Consequence: CLN8 NM_018941.4 intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: -0.207

Genes affected

CLN8 (HGNC:2079): (CLN8 transmembrane ER and ERGIC protein) This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with a disorder characterized by progressive epilepsy with cognitive disabilities (EPMR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2017]

CLN8-AS1 (HGNC:55523): (CLN8 antisense RNA 1)

KBTBD11-OT1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CLN8	NM_018941.4	c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC		intron_variant	Intron 1 of 2	ENST00000331222.6	NP_061764.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CLN8	ENST00000331222.6	c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC		intron_variant	Intron 1 of 2	1	NM_018941.4	ENSP00000328182.4
KBTBD11-OT1	ENST00000635855.1	n.-187_-186insAGCCCAGGTGAGCGCTCAGGG		upstream_gene_variant		5		ENSP00000489726.1

Frequencies

GnomAD3 genomes AF: 0.000139 AC: 21 AN: 151238 Hom.: 0 Cov.: 28

Gnomad AFR AF: 0.000121

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000722

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000591

Gnomad OTH AF: 0.000480

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.000139 AC: 21 AN: 151346 Hom.: 0 Cov.: 28 AF XY: 0.000135 AC XY: 10 AN XY: 73958

Gnomad4 AFR AF: 0.000121

Gnomad4 AMR AF: 0.000722

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000591

Gnomad4 OTH AF: 0.000475

Alfa AF: 0.0000843 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Jan 30, 2017

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

A variant of uncertain significance has been identified in the CLN8 gene. The c.-125_-124+19dup21 variant has not been published as a pathogenic variant, nor has it been reported as a benign variant to our knowledge. This variant spans the 3' end of the noncoding exon 1 and the donor site of intron 2. Several in-silico splice prediction models predict that c.-125_-124+19dup21 creates a cryptic donor site downstream of the natural splice site, leading to abnormal gene splicing. However, in the absence of RNA/functional studies, the actual effect of this sequence change in this individual is unknown. Additionally, to our knowledge, splice and regulatory variants have not been reported in CLN8 in association with NCL (Stenson et al., 2014). Therefore, based on the currently available information, it is unclear whether this variant is a pathogenic variant or a rare benign variant. -

Neuronal ceroid lipofuscinosis Uncertain:1

May 28, 2019

Mendelics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064793088; hg19: chr8-1712044;