chr8-1763878-C-CAGCCCAGGTGAGCGCTCAGGG
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_018941.4(CLN8):c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000139 in 151,346 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_018941.4 intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CLN8 | NM_018941.4 | c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC | intron_variant | Intron 1 of 2 | ENST00000331222.6 | NP_061764.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CLN8 | ENST00000331222.6 | c.-125_-124+19dupAGGTGAGCGCTCAGGGAGCCC | intron_variant | Intron 1 of 2 | 1 | NM_018941.4 | ENSP00000328182.4 | |||
KBTBD11-OT1 | ENST00000635855.1 | n.-187_-186insAGCCCAGGTGAGCGCTCAGGG | upstream_gene_variant | 5 | ENSP00000489726.1 |
Frequencies
GnomAD3 genomes AF: 0.000139 AC: 21AN: 151238Hom.: 0 Cov.: 28
GnomAD4 exome Cov.: 0
GnomAD4 genome AF: 0.000139 AC: 21AN: 151346Hom.: 0 Cov.: 28 AF XY: 0.000135 AC XY: 10AN XY: 73958
ClinVar
Submissions by phenotype
not specified Uncertain:1
A variant of uncertain significance has been identified in the CLN8 gene. The c.-125_-124+19dup21 variant has not been published as a pathogenic variant, nor has it been reported as a benign variant to our knowledge. This variant spans the 3' end of the noncoding exon 1 and the donor site of intron 2. Several in-silico splice prediction models predict that c.-125_-124+19dup21 creates a cryptic donor site downstream of the natural splice site, leading to abnormal gene splicing. However, in the absence of RNA/functional studies, the actual effect of this sequence change in this individual is unknown. Additionally, to our knowledge, splice and regulatory variants have not been reported in CLN8 in association with NCL (Stenson et al., 2014). Therefore, based on the currently available information, it is unclear whether this variant is a pathogenic variant or a rare benign variant. -
Neuronal ceroid lipofuscinosis Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at