NM_019101.3:c.261_269+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC

Variant names:

• chr6-31656615-TACCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATC-T
• rs1800092968
• NM_019101.3:c.261_269+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_019101.3(APOM):​c.261_269+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC​(p.Ile88_Met90del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant allele was found at a frequency of 0.00000248 in 1,613,824 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: APOM NM_019101.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.55
• Publications: 0 publications found

Genes affected

APOM (HGNC:13916): (apolipoprotein M) The protein encoded by this gene is an apolipoprotein and member of the lipocalin protein family. It is found associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. The encoded protein is secreted through the plasma membrane but remains membrane-bound, where it is involved in lipid transport. Alternate splicing results in both coding and non-coding variants of this gene. [provided by RefSeq, Jan 2012]

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_019101.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_019101.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	APOM	NM_019101.3	MANE Select	c.261_269+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC	p.Ile88_Met90del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 2 of 6	NP_061974.2
	APOM	NM_001256169.2		c.45_53+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC	p.Ile16_Met18del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 2 of 6	NP_001243098.1	O95445-2
	APOM	NR_045828.2		n.295_310+21delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC		splice_donor splice_region intron non_coding_transcript_exon	Exon 2 of 6

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	APOM	ENST00000375916.4	TSL:1 MANE Select	c.259_269+26delACCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATC	p.Thr87AsnfsTer6	frameshift splice_donor splice_region intron	Exon 2 of 6	ENSP00000365081.3	O95445-1
	APOM	ENST00000375920.8	TSL:1	c.43_53+26delACCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATC	p.Thr15AsnfsTer6	frameshift splice_donor splice_region intron	Exon 2 of 6	ENSP00000365085.4	O95445-2
	APOM	ENST00000375918.6	TSL:2	c.43_53+26delACCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATC	p.Thr15AsnfsTer6	frameshift splice_donor splice_region intron	Exon 2 of 5	ENSP00000365083.2	Q5SRP5

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152198 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461626 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727142

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.0000671 AC: 3 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26112

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86244

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53324

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111896

Other (OTH) AF: 0.00 AC: 0 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00194278), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152198 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74362

African (AFR) AF: 0.00 AC: 0 AN: 41444

American (AMR) AF: 0.0000655 AC: 1 AN: 15276

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5202

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2092

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1800092968; hg19: chr6-31624392;